fn() cutNsCut out all masked sequences from a Dna5String.
Cut out all masked sequences from a Dna5String.
Defined in | <seqan/alignment_free.h> |
---|---|
Signature |
void cutNs(sequenceCut, sequence);
|
Parameters
sequenceCut
|
Dna5String similar to sequence with all Ns cut out. |
---|---|
sequence
|
Masked DNA sequence. |
Detailed Description
This function concatenates the nonmasked parts of the sequence, thereby changing the word content. If you want to remove the masked parts of a sequence without concatenation, use stringToStringSet.
Examples
Transform a masked DNA sequence into an unmasked sequences with all masked parts cut out
using namespace seqan; Dna5String sequenceMasked = "NNNNNNTTTCCGAAAAGGTANNNNNGCAACTTTANNNCGTGATCAAAGTTTTCCCCGTCGAAATTGGGNNTG"; Dna5String sequenceMaskedPartsRemoved; cutNs(sequenceMaskedPartsRemoved, sequenceMasked); // Print the masked sequence std::cout<<sequenceMasked<<"\n"; // Print the sequence with the masked parts removed std::cout<<sequenceMaskedPartsRemoved<<"\n"; // sequenceMasked = // "NNNNNNTTTCCGAAAAGGTANNNNNGCAACTTTANNNCGTGATCAAAGTTTTCCCCGTCGAAATTGGGNNTG" // sequenceMaskedPartsRemoved = // "TTTCCGAAAAGGTAGCAACTTTACGTGATCAAAGTTTTCCCCGTCGAAATTGGGTG"