fn() extendAlignmentX-Drop extension for alignment objects.
X-Drop extension for alignment objects.
Defined in | <seqan/align_extend.h> |
---|---|
Signature |
TScoreValue extendAlignment(align, [origScore,] hSeq, vSeq, positions, extensionDirection,
[lowerDiag, upperDiag,] [xDrop,] scoreScheme);
|
Parameters
align
|
The Align object to work on. Must be an alignment over the infix of the const type of hSeq and vSeq. Also see section "Returned Alignment". |
---|---|
origScore
|
Original score value of the alignment (optional; computed if not provided). |
hSeq
|
Full horizontal sequence. |
vSeq
|
Full vertical sequence. |
positions
|
A Tuple of length 4 with the begin and end position of the infixes in align. |
extensionDirection
|
The extension direction (ExtensionDirection). |
lowerDiag
|
Lower alignment diagonal to use (int). |
upperDiag
|
Upper alignment diagonal to use (int). |
xDrop
|
The X-drop value to use (integral value). It only limits computation of new columns in the DP-Matrix and has no influence on the diagonals (but can be combined with them). |
scoringScheme
|
The Score to use. |
Return Values
TScoreValue |
The score of the new alignment. TScoreValue is the value type of scoringScheme. |
---|
Detailed Description
Returned Alignment
The resulting alignment has the infixes extended to the whole underlying sequence. The alignment is clipped to give the parts of the aligned sequences.
Example
#include <iostream> #include <seqan/align.h> #include <seqan/align_extend.h> #include <seqan/sequence.h> using namespace seqan; int main() { Score<int> sc(2, -1, -2); Align<Infix<CharString const>::Type> align; resize(rows(align), 2); // We create the following initial situation with subject/query and the // infixes thereof. // // infixes/seeds // <--> // subject NNNNNNNNNNTTCCGGGACGGTACACACACGGGGGGGGGG // query CTCGGGACGGTACAGGCACGGTTTTTTTT CharString subject = "NNNNNNNNNNTTCCGGGACGGTACACACACGGGGGGGGGG"; CharString query = "CTCGGGACGGTACAGGCACGGTTTTTTTT"; assignSource(row(align, 0), infix(subject, 19, 23)); assignSource(row(align, 1), infix(query, 8, 12)); int score = globalAlignment(align, sc); std::cout << "Initial alignment of infixes (score == " << score << ")\n\n" << align; // The alignment starts at diagonal (23 - 19) = 4. A band of 4 in each direction has // the following diagonals. int lDiag = 0, uDiag = 8; // Set the x-Drop value to 5. int xDrop = 5; Tuple<unsigned, 4> positions = { {19u, 8u, 23u, 12u} }; score = extendAlignment(align, score, subject, query, positions, EXTEND_BOTH, lDiag, uDiag, xDrop, sc); std::cout << "Resulting alignment (score == " << score << ")\n\n" << align; std::cout << "source(row(align, 0)) == " << source(row(align, 0)) << " (full sequence)\n" << "source(row(align, 1)) == " << source(row(align, 1)) << " (full sequence)\n" << "\n" << "clipping positions of row 0: " << clippedBeginPosition(row(align, 0)) << ", " << clippedEndPosition(row(align, 0)) << "\n" << "clipping positions of row 1: " << clippedBeginPosition(row(align, 1)) << ", " << clippedEndPosition(row(align, 1)) << "\n"; return 0; }
The output is as follows:
Initial alignment of infixes (score == 8) 0 GGTA |||| GGTA Resulting alignment (score == 32) 0 . : . CGGGACGGTACACACACGG |||||||||||| ||||| CGGGACGGTACAGGCACGG source(row(align, 0)) == NNNNNNNNNNTTCCGGGACGGTACACACACGGGGGGGGGG (full sequence) source(row(align, 1)) == CTCGGGACGGTACAGGCACGGTTTTTTTT (full sequence) clipping positions of row 0: 13, 32 clipping positions of row 1: 2, 21
Remarks
It is necessary to explicitly pass hSeq, vSeq and the positions, because the original hSeq and vSeq (that Align was created on), might have been infixes, (especially if they are members of a ConcatDirect set) in which cases their actual begin and end positions cannot be inferred from the Align object's rows' source().