fn() cutNsCut out all masked sequences from a Dna5String.
Cut out all masked sequences from a Dna5String.
Defined in | <seqan/alignment_free.h> |
---|---|
Signature |
void cutNs(sequenceCut, sequence);
|
Parameters
sequenceCut
|
Dna5String similar to sequence with all Ns cut out. |
---|---|
sequence
|
Masked DNA sequence. |
Detailed Description
This function concatenates the nonmasked parts of the sequence, thereby changing the word content. If you want to remove the masked parts of a sequence without concatenation, use stringToStringSet.
Examples
Transform a masked DNA sequence into an unmasked sequences with all masked parts cut out
using namespace seqan;
Dna5String sequenceMasked =
"NNNNNNTTTCCGAAAAGGTANNNNNGCAACTTTANNNCGTGATCAAAGTTTTCCCCGTCGAAATTGGGNNTG";
Dna5String sequenceMaskedPartsRemoved;
cutNs(sequenceMaskedPartsRemoved, sequenceMasked);
// Print the masked sequence
std::cout<<sequenceMasked<<"\n";
// Print the sequence with the masked parts removed
std::cout<<sequenceMaskedPartsRemoved<<"\n";
// sequenceMasked =
// "NNNNNNTTTCCGAAAAGGTANNNNNGCAACTTTANNNCGTGATCAAAGTTTTCCCCGTCGAAATTGGGNNTG"
// sequenceMaskedPartsRemoved =
// "TTTCCGAAAAGGTAGCAACTTTACGTGATCAAAGTTTTCCCCGTCGAAATTGGGTG"
Data Races
If not stated otherwise, concurrent invocation is not guaranteed to be thread-safe.