The three letter RNA structure alphabet of the characters ".()". More...

#include <seqan3/alphabet/structure/dot_bracket3.hpp>

Inheritance diagram for seqan3::dot_bracket3:

Public Member Functions
Constructors, destructor and assignment
constexpr	dot_bracket3 () noexcept=default
	Defaulted.

constexpr	dot_bracket3 (dot_bracket3 const &) noexcept=default
	Defaulted.

constexpr	dot_bracket3 (dot_bracket3 &&) noexcept=default
	Defaulted.

constexpr dot_bracket3 &	operator= (dot_bracket3 const &) noexcept=default
	Defaulted.

constexpr dot_bracket3 &	operator= (dot_bracket3 &&) noexcept=default
	Defaulted.

	~dot_bracket3 () noexcept=default
	Defaulted.

Public Member Functions inherited from seqan3::alphabet_base< dot_bracket3, 3 >
constexpr	alphabet_base () noexcept=default
	Defaulted.

constexpr	alphabet_base (alphabet_base const &) noexcept=default
	Defaulted.

constexpr	alphabet_base (alphabet_base &&) noexcept=default
	Defaulted.

constexpr alphabet_base &	operator= (alphabet_base const &) noexcept=default
	Defaulted.

constexpr alphabet_base &	operator= (alphabet_base &&) noexcept=default
	Defaulted.

	~alphabet_base () noexcept=default
	Defaulted.

constexpr char_type	to_char () const noexcept
	Return the letter as a character of char_type.

constexpr rank_type	to_rank () const noexcept
	Return the letter's numeric value (rank in the alphabet).

constexpr dot_bracket3 &	assign_char (char_type const chr) noexcept
	Assign from a character, implicitly converts invalid characters.

constexpr dot_bracket3 &	assign_rank (rank_type const c) noexcept
	Assign from a numeric value.

Private Types
using	base_t = alphabet_base< dot_bracket3, 3 >
	The base class.

Static Private Member Functions
static constexpr rank_type	char_to_rank (char_type const chr)
	Returns the rank representation of character.

static constexpr char_type	rank_to_char (rank_type const rank)
	Returns the character representation of rank.

Private Attributes
friend	base_t
	Befriend seqan3::alphabet_base.

Static Private Attributes
static constexpr std::array< rank_type, 256 >	char_to_rank_table
	The lookup table used in char_to_rank.

static constexpr char_type	rank_to_char_table [alphabet_size] {'.', '(', ')'}
	The lookup table used in rank_to_char.

Related Symbols
(Note that these are not member symbols.)
Structure literals
constexpr dot_bracket3	operator""_db3 (char const ch) noexcept
	The seqan3::db3 char literal.

constexpr std::vector< dot_bracket3 >	operator""_db3 (char const *str, std::size_t len)
	The seqan3::db3 string literal.

Related Symbols inherited from semialphabet
template<cereal_output_archive archive_t, semialphabet alphabet_t>
alphabet_rank_t< alphabet_t >	save_minimal (archive_t const &, alphabet_t const &l)
	Save an alphabet letter to stream.

template<cereal_input_archive archive_t, typename wrapped_alphabet_t >
void	load_minimal (archive_t const &, wrapped_alphabet_t &&l, alphabet_rank_t< detail::strip_cereal_wrapper_t< wrapped_alphabet_t > > const &r)
	Restore an alphabet letter from a saved rank.

RNA structure properties
static constexpr uint8_t	max_pseudoknot_depth {1u}
	The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth.

constexpr bool	is_pair_open () const noexcept
	Check whether the character represents a rightward interaction in an RNA structure.

constexpr bool	is_pair_close () const noexcept
	Check whether the character represents a leftward interaction in an RNA structure.

constexpr bool	is_unpaired () const noexcept
	Check whether the character represents an unpaired position in an RNA structure.

constexpr std::optional< uint8_t >	pseudoknot_id () const noexcept
	Get an identifier for a pseudoknotted interaction, where opening and closing brackets of the same type have the same id.

Additional Inherited Members
Static Public Attributes inherited from seqan3::alphabet_base< dot_bracket3, 3 >
static constexpr detail::min_viable_uint_t< size >	alphabet_size
	The size of the alphabet, i.e. the number of different values it can take.

Protected Types inherited from seqan3::alphabet_base< dot_bracket3, 3 >
using	char_type = std::conditional_t< std::same_as< char, void >, char, char >
	The char representation; conditional needed to make semi alphabet definitions legal.

using	rank_type = detail::min_viable_uint_t< size - 1 >
	The type of the alphabet when represented as a number (e.g. via to_rank()).

Detailed Description

The three letter RNA structure alphabet of the characters ".()".

The brackets denote RNA base pair interactions. Every left bracket must have a corresponding right bracket. Pseudoknots cannot be expressed in this format. A dot (.) represents a character that is not paired.

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA

(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))).

Example

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <seqan3/alphabet/structure/dot_bracket3.hpp>
#include <seqan3/core/debug_stream.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dot_bracket3 letter{'.'_db3};
 
    letter.assign_char('(');
    seqan3::debug_stream << letter << '\n'; // prints "("
 
    letter.assign_char('F');                // Unknown characters are implicitly converted to '.'.
    seqan3::debug_stream << letter << '\n'; // prints "."
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

Member Function Documentation

◆ char_to_rank()

static constexpr rank_type seqan3::dot_bracket3::char_to_rank ( char_type const chr )

inlinestaticconstexprprivate

Returns the rank representation of character.

This function is required by seqan3::alphabet_base.

◆ is_pair_close()

constexpr bool seqan3::dot_bracket3::is_pair_close ( ) const

inlineconstexprnoexcept

Check whether the character represents a leftward interaction in an RNA structure.

Returns: True if the letter represents a leftward interaction, False otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ is_pair_open()

constexpr bool seqan3::dot_bracket3::is_pair_open ( ) const

inlineconstexprnoexcept

Check whether the character represents a rightward interaction in an RNA structure.

Returns: True if the letter represents a rightward interaction, False otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ is_unpaired()

constexpr bool seqan3::dot_bracket3::is_unpaired ( ) const

inlineconstexprnoexcept

Check whether the character represents an unpaired position in an RNA structure.

Returns: True if the letter represents an unpaired site, False otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ pseudoknot_id()

constexpr std::optional< uint8_t > seqan3::dot_bracket3::pseudoknot_id ( ) const

inlineconstexprnoexcept

Get an identifier for a pseudoknotted interaction, where opening and closing brackets of the same type have the same id.

Returns: The pseudoknot id (always 0) if alph denotes an interaction, and no value otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ rank_to_char()

static constexpr char_type seqan3::dot_bracket3::rank_to_char ( rank_type const rank )

inlinestaticconstexprprivate

Returns the character representation of rank.

This function is required by seqan3::alphabet_base.

Friends And Related Symbol Documentation

◆ operator""_db3() [1/2]

constexpr std::vector< dot_bracket3 > operator""_db3	(	char const *	str,
		std::size_t	len
	)

Parameters

[in]	str	A pointer to the character string to assign.
[in]	len	The size of the character string to assign.

Returns: std::vector<seqan3::dot_bracket3>

You can use this string literal to easily assign to std::vector<seqan3::dot_bracket3>:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <seqan3/alphabet/structure/dot_bracket3.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    std::vector<seqan3::dot_bracket3> sequence1{".(..)."_db3};
    std::vector<seqan3::dot_bracket3> sequence2 = ".(..)."_db3;
    auto sequence3 = ".(..)."_db3;
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ operator""_db3() [2/2]

constexpr dot_bracket3 operator""_db3 ( char const ch )

Parameters

[in] ch The character to represent as dot bracket.

Returns: seqan3::dot_bracket3

You can use this char literal to assign a seqan3::dot_bracket3 character:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <seqan3/alphabet/structure/dot_bracket3.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dot_bracket3 letter1{'('_db3};
    auto letter2 = '('_db3;
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

Member Data Documentation

◆ char_to_rank_table

constexpr std::array<rank_type, 256> seqan3::dot_bracket3::char_to_rank_table

staticconstexprprivate

Initial value:

{
        []() constexpr {
            std::array<rank_type, 256> rank_table{};
 
            
            rank_table.fill(0u);
 
            
            rank_table['.'] = 0u;
            rank_table['('] = 1u;
            rank_table[')'] = 2u;
 
            return rank_table;
        }()
    }

The lookup table used in char_to_rank.

We would have defined these lookup tables directly within their respective constexpr functions, but at the time of writing this, gcc did not (clang >= 4 did!) auto-generate lookup tables.

static constexpr char_type rank_to_char(rank_type const rank)
{
    // not possible because of static not being allowed within a constexpr function
    static constexpr lookup_table = ...;
    return lookup_table[rank];
}
 
static constexpr char_type rank_to_char(rank_type const rank)
{
    // up-to the compiler to optimise, no guarantee that a lookup table is used.
    constexpr lookup_table = ...;
    return lookup_table[rank];
}

See also: https://gcc.gnu.org/bugzilla/show_bug.cgi?id=99320 for the progress on gcc

◆ max_pseudoknot_depth

constexpr uint8_t seqan3::dot_bracket3::max_pseudoknot_depth {1u}

staticconstexpr

The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth.

It is the number of distinct pairs of interaction symbols the format supports. The value 1 denotes no pseudoknot support.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ rank_to_char_table

constexpr char_type seqan3::dot_bracket3::rank_to_char_table[alphabet_size] {'.', '(', ')'}

staticconstexprprivate

The lookup table used in rank_to_char.

We would have defined these lookup tables directly within their respective constexpr functions, but at the time of writing this, gcc did not (clang >= 4 did!) auto-generate lookup tables.

static constexpr char_type rank_to_char(rank_type const rank)
{
    // not possible because of static not being allowed within a constexpr function
    static constexpr lookup_table = ...;
    return lookup_table[rank];
}
 
static constexpr char_type rank_to_char(rank_type const rank)
{
    // up-to the compiler to optimise, no guarantee that a lookup table is used.
    constexpr lookup_table = ...;
    return lookup_table[rank];
}

See also: https://gcc.gnu.org/bugzilla/show_bug.cgi?id=99320 for the progress on gcc

The documentation for this class was generated from the following file:

dot_bracket3.hpp

Public Member Functions

Private Types

Static Private Member Functions

Private Attributes

Static Private Attributes

Related Symbols

RNA structure properties

Additional Inherited Members

Detailed Description

Example

Member Function Documentation

◆ char_to_rank()

◆ is_pair_close()

◆ is_pair_open()

◆ is_unpaired()

◆ pseudoknot_id()

◆ rank_to_char()

Friends And Related Symbol Documentation

◆ operator""_db3() [1/2]

◆ operator""_db3() [2/2]

Member Data Documentation

◆ char_to_rank_table

◆ max_pseudoknot_depth

◆ rank_to_char_table