SeqAn3  3.0.2
The Modern C++ library for sequence analysis.
seqan3::fields< fs > Struct Template Reference

A class template that holds a choice of seqan3::field. More...

#include <seqan3/io/record.hpp>

Related Functions

(Note that these are not member functions.)

template<typename t >
SEQAN3_CONCEPT fields_specialisation = is_value_specialisation_of_v<t, fields>
 Auxiliary concept that checks whether a type is a specialisation of seqan3::fields.
 

Detailed Description

template<field ... fs>
struct seqan3::fields< fs >

A class template that holds a choice of seqan3::field.

Template Parameters
fsThe fields you wish to be present in the seqan3::record returned by your file.
See also
seqan3::record

This class acts as a compile time list of seqan3::field elements. It is used in specialising file classes to determine the elements in a seqan3::record.

Example

#include <sstream>
auto input = R"(> TEST1
ACGT
> Test2
AGGCTGA
> Test3
GGAGTATAATATATATATATATAT)";
int main()
{
using seqan3::get;
// specify custom field combination/order to file:
auto record = fin.front(); // get current record, in this case the first
// record is tuple-like type, but allows access via field identifiers:
auto & id = get<seqan3::field::id>(record);
auto & seq = get<seqan3::field::seq>(record);
}

The documentation for this struct was generated from the following file:
sstream
std::istringstream
record.hpp
Provides the seqan3::record template and the seqan3::field enum.
input.hpp
Provides seqan3::sequence_file_input and corresponding traits classes.
seqan3::format_fasta
The FastA format.
Definition: format_fasta.hpp:79
seqan3::fields
A class template that holds a choice of seqan3::field.
Definition: record.hpp:165
seqan3::seq
constexpr sequenced_policy seq
Global execution policy object for sequenced execution policy.
Definition: execution.hpp:54
output.hpp
Provides seqan3::sequence_file_output and corresponding traits classes.
seqan3::sequence_file_input
A class for reading sequence files, e.g. FASTA, FASTQ ...
Definition: input.hpp:315
seqan3::get
constexpr const auto & get(configuration< configs_t... > const &config) noexcept
This is an overloaded member function, provided for convenience. It differs from the above function o...
Definition: configuration.hpp:589