SeqAn3  3.0.2
The Modern C++ library for sequence analysis.
seqan3::sequence_file_input_default_traits_dna Struct Reference

The default traits for seqan3::sequence_file_input. More...

#include <seqan3/io/sequence_file/input.hpp>

+ Inheritance diagram for seqan3::sequence_file_input_default_traits_dna:

Member types

Definitions to satisfy seqan3::sequence_file_input_traits.

using sequence_alphabet = dna5
 The sequence alphabet is seqan3::dna5.
 
using sequence_legal_alphabet = dna15
 The legal sequence alphabet for parsing is seqan3::dna15.
 
template<typename _sequence_alphabet >
using sequence_container = std::vector< _sequence_alphabet >
 The type of a DNA sequence is std::vector.
 
using id_alphabet = char
 The alphabet for an identifier string is char.
 
template<typename _id_alphabet >
using id_container = std::basic_string< _id_alphabet >
 The string type for an identifier is std::basic_string.
 
using quality_alphabet = phred42
 The alphabet for a quality annotation is seqan3::phred42.
 
template<typename _quality_alphabet >
using quality_container = std::vector< _quality_alphabet >
 The string type for a quality annotation is std::vector.
 

Detailed Description

The default traits for seqan3::sequence_file_input.

If you wish to change a single or a few types from the default, just inherit from this class and "overwrite" the respective type definitions.

This example will make the file read into a smaller alphabet and a compressed container:

#include <sstream>
auto input = R"(> TEST1
ACGT
> Test2
AGGCTGA
> Test3
GGAGTATAATATATATATATATAT)";
{
using sequence_alphabet = seqan3::dna4; // instead of dna5
template <typename alph>
using sequence_container = seqan3::bitcompressed_vector<alph>; // must be defined as a template!
};
int main()
{
}

The documentation for this struct was generated from the following file:
sstream
dna4.hpp
Provides seqan3::dna4, container aliases and string literals.
sequence_container
A more refined container concept than seqan3::container.
std::istringstream
input.hpp
Provides seqan3::sequence_file_input and corresponding traits classes.
seqan3::format_fasta
The FastA format.
Definition: format_fasta.hpp:80
seqan3::dna4
The four letter DNA alphabet of A,C,G,T.
Definition: dna4.hpp:51
seqan3::sequence_file_input_default_traits_dna::sequence_alphabet
dna5 sequence_alphabet
The sequence alphabet is seqan3::dna5.
Definition: input.hpp:140
bitcompressed_vector.hpp
Provides seqan3::bitcompressed_vector.
seqan3::sequence_file_input
A class for reading sequence files, e.g. FASTA, FASTQ ...
Definition: input.hpp:316
seqan3::bitcompressed_vector
A space-optimised version of std::vector that compresses multiple letters into a single byte.
Definition: bitcompressed_vector.hpp:65
seqan3::sequence_file_input_default_traits_dna
The default traits for seqan3::sequence_file_input.
Definition: input.hpp:133