SeqAn3  3.0.2
The Modern C++ library for sequence analysis.
seqan3::structure_file_input_default_traits_rna Struct Reference

The default traits for seqan3::structure_file_input. More...

#include <seqan3/io/structure_file/input.hpp>

+ Inheritance diagram for seqan3::structure_file_input_default_traits_rna:

Member types

Definitions to satisfy seqan3::structure_file_input_traits.

using seq_alphabet = rna5
 The sequence alphabet is seqan3::rna5.
 
using seq_legal_alphabet = rna15
 The legal sequence alphabet for parsing is seqan3::rna15.
 
template<typename _seq_alphabet >
using seq_container = std::vector< _seq_alphabet >
 The type of an RNA sequence is std::vector.
 
using id_alphabet = char
 The alphabet for an identifier string is char.
 
template<typename _id_alphabet >
using id_container = std::basic_string< _id_alphabet >
 The string type for an identifier is std::basic_string.
 
using bpp_prob = double
 The type for a base pair probability is double.
 
using bpp_partner = size_t
 The type for the partner position of a base pair probability is size_t.
 
template<typename _bpp_prob , typename _bpp_partner >
using bpp_item = std::pair< _bpp_prob, _bpp_partner >
 The type of a base pair item is std::pair<double, size_t>.
 
template<typename _bpp_item >
using bpp_queue = std::set< _bpp_item >
 A queue of base pair items sorted by probability is realised with std::set.
 
template<typename _bpp_queue >
using bpp_container = std::vector< _bpp_queue >
 A string over all bases containing the respective interaction queues is represented as std::vector.
 
using structure_alphabet = wuss51
 The alphabet for a structure annotation is seqan3::phred42.
 
template<typename _structure_alphabet >
using structure_container = std::vector< _structure_alphabet >
 The string type for a structure annotation is std::vector.
 
template<typename _seq_alphabet , typename _structure_alphabet >
using structured_seq_alphabet = structured_rna< _seq_alphabet, _structure_alphabet >
 The combined structured sequence alphabet is seqan3::structured_rna<seqan3::rna5, seqan3::wuss51>.
 
template<typename _structured_seq_alphabet >
using structured_seq_container = std::vector< _structured_seq_alphabet >
 The type of a structured RNA sequence is std::vector.
 
using energy_type = std::optional< double >
 The type of the energy is std::optional<double>.
 
using react_type = double
 The type of the reactivity and reactivity error is double.
 
template<typename _react_type >
using react_container = std::vector< _react_type >
 The type of a string of reactivity values is std::vector.
 
using comment_alphabet = char
 The alphabet for a comment string is char.
 
template<typename _comment_alphabet >
using comment_container = std::basic_string< _comment_alphabet >
 The string type for a comment is std::basic_string.
 
using offset_type = size_t
 The type of the offset is size_t.
 

Detailed Description

The default traits for seqan3::structure_file_input.

If you wish to change a single or a few types from the default, just inherit from this class and "overwrite" the respective type definitions.

This example will make the file read into a smaller alphabet:

#include <sstream>
// Define custom traits
{
using seq_alphabet = seqan3::rna4; // instead of rna5
};
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
UUGGAGUACACAACCUGUACACUCUUUC
..(((((..(((...)))..)))))... (-3.71))";
int main()
{
}

The documentation for this struct was generated from the following file:
debug_stream.hpp
Provides seqan3::debug_stream and related types.
sstream
std::istringstream
seqan3::rna4
The four letter RNA alphabet of A,C,G,U.
Definition: rna4.hpp:46
rna4.hpp
Provides seqan3::rna4, container aliases and string literals.
seqan3::format_vienna
The Vienna format (dot bracket notation) for RNA sequences with secondary structure.
Definition: format_vienna.hpp:83
seqan3::structure_file_input
A class for reading structured sequence files, e.g. Stockholm, Connect, Vienna, ViennaRNA bpp matrix ...
Definition: input.hpp:463
seqan3::structure_file_input_default_traits_rna::seq_alphabet
rna5 seq_alphabet
The sequence alphabet is seqan3::rna5.
Definition: input.hpp:229
seqan3::structure_file_input_default_traits_rna
The default traits for seqan3::structure_file_input.
Definition: input.hpp:219
input.hpp
Provides seqan3::structure_file_input and corresponding traits classes.