seqan3::sequence_file_input_default_traits_dna Struct Reference

The default traits for seqan3::sequence_file_input. More...

#include <seqan3/io/sequence_file/input.hpp>

Inheritance diagram for seqan3::sequence_file_input_default_traits_dna:

Public Types
Member types
Definitions to satisfy seqan3::sequence_file_input_traits.
using	sequence_alphabet = dna5
	The sequence alphabet is seqan3::dna5.
using	sequence_legal_alphabet = dna15
	The legal sequence alphabet for parsing is seqan3::dna15.
template<typename _sequence_alphabet >
using	sequence_container = std::vector< _sequence_alphabet >
	The type of a DNA sequence is std::vector.
using	id_alphabet = char
	The alphabet for an identifier string is char.
template<typename _id_alphabet >
using	id_container = std::basic_string< _id_alphabet >
	The string type for an identifier is std::basic_string.
using	quality_alphabet = phred42
	The alphabet for a quality annotation is seqan3::phred42.
template<typename _quality_alphabet >
using	quality_container = std::vector< _quality_alphabet >
	The string type for a quality annotation is std::vector.

Detailed Description

The default traits for seqan3::sequence_file_input.

If you wish to change a single or a few types from the default, just inherit from this class and "overwrite" the respective type definitions.

This example will make the file read into a smaller alphabet and a compressed container:

#include <sstream>
 
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/io/sequence_file/input.hpp>
#include <seqan3/range/container/bitcompressed_vector.hpp>
 
auto input = R"(> TEST1
ACGT
> Test2
AGGCTGA
> Test3
GGAGTATAATATATATATATATAT)";
 
struct my_traits : seqan3::sequence_file_input_default_traits_dna
{
    using sequence_alphabet = seqan3::dna4;               // instead of dna5
 
    template <typename alph>
    using sequence_container = seqan3::bitcompressed_vector<alph>; // must be defined as a template!
};
 
int main()
{
    seqan3::sequence_file_input<my_traits> fin{std::istringstream{input}, seqan3::format_fasta{}};
}

---

The documentation for this struct was generated from the following file:

• seqan3/io/sequence_file/input.hpp