seqan3::fields< fs > Struct Template Reference

A class template that holds a choice of seqan3::field. More...

#include <seqan3/io/record.hpp>

Static Private Member Functions
static constexpr bool	contains (field f)
	Whether a field is contained in the parameter pack.
static constexpr size_t	index_of (field f)
	Retrieve the position of field in the parameter pack.

Static Private Attributes
static constexpr std::array< field, sizeof...(fs)>	as_array {fs...}
	The template parameters stored in an array for easy access.
static constexpr size_t	npos = std::numeric_limits<size_t>::max()
	Special value that indicates that index_of() failed.
static constexpr size_t	size = sizeof...(fs)
	The size of fields.

Detailed Description

template<field... fs>
struct seqan3::fields< fs >

A class template that holds a choice of seqan3::field.

Template Parameters

fs	The fields you wish to be present in the seqan3::record returned by your file.

See also

seqan3::record

This class acts as a compile time list of seqan3::field elements. It is used in specialising file classes to determine the elements in a seqan3::record.

Example

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/io/record.hpp>
#include <seqan3/io/sequence_file/input.hpp>
#include <seqan3/io/sequence_file/output.hpp>
 
auto input = R"(> TEST1
ACGT
> Test2
AGGCTGA
> Test3
GGAGTATAATATATATATATATAT)";
 
int main()
{
    // specify custom field combination/order to file:
    seqan3::sequence_file_input fin{std::istringstream{input},
                                    seqan3::format_fasta{},
                                    seqan3::fields<seqan3::field::id, seqan3::field::seq>{}};
 
    auto record = fin.front(); // get current record, in this case the first
 
    auto & id = record.id();
    seqan3::debug_stream << id << '\n'; // TEST1
    auto & seq = record.sequence();
    seqan3::debug_stream << seq << '\n'; // ACGT
}

---

The documentation for this struct was generated from the following file:

• record.hpp