seqan3::dot_bracket3 Class Reference

The three letter RNA structure alphabet of the characters ".()". More...

#include <seqan3/alphabet/structure/dot_bracket3.hpp>

Inheritance diagram for seqan3::dot_bracket3:

Public Member Functions
Constructors, destructor and assignment
constexpr	dot_bracket3 () noexcept=default
	Defaulted.
constexpr	dot_bracket3 (dot_bracket3 const &) noexcept=default
	Defaulted.
constexpr	dot_bracket3 (dot_bracket3 &&) noexcept=default
	Defaulted.
constexpr dot_bracket3 &	operator= (dot_bracket3 const &) noexcept=default
	Defaulted.
constexpr dot_bracket3 &	operator= (dot_bracket3 &&) noexcept=default
	Defaulted.
	~dot_bracket3 () noexcept=default
	Defaulted.
Public Member Functions inherited from seqan3::alphabet_base< dot_bracket3, 3 >
constexpr	alphabet_base () noexcept=default
	Defaulted.
constexpr	alphabet_base (alphabet_base const &) noexcept=default
	Defaulted.
constexpr	alphabet_base (alphabet_base &&) noexcept=default
	Defaulted.
constexpr alphabet_base &	operator= (alphabet_base const &) noexcept=default
	Defaulted.
constexpr alphabet_base &	operator= (alphabet_base &&) noexcept=default
	Defaulted.
	~alphabet_base () noexcept=default
	Defaulted.
constexpr char_type	to_char () const noexcept
	Return the letter as a character of char_type. More...
constexpr rank_type	to_rank () const noexcept
	Return the letter's numeric value (rank in the alphabet). More...
constexpr dot_bracket3 &	assign_char (char_type const chr) noexcept
	Assign from a character, implicitly converts invalid characters. More...
constexpr dot_bracket3 &	assign_rank (rank_type const c) noexcept
	Assign from a numeric value. More...

Related Functions
(Note that these are not member functions.)
Structure literals
constexpr dot_bracket3	operator""_db3 (char const ch) noexcept
	The seqan3::db3 char literal. More...
std::vector< dot_bracket3 >	operator""_db3 (const char *str, std::size_t len)
	The seqan3::db3 string literal. More...

RNA structure properties
static constexpr uint8_t	max_pseudoknot_depth {1u}
	The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth. More...
constexpr bool	is_pair_open () const noexcept
	Check whether the character represents a rightward interaction in an RNA structure. More...
constexpr bool	is_pair_close () const noexcept
	Check whether the character represents a leftward interaction in an RNA structure. More...
constexpr bool	is_unpaired () const noexcept
	Check whether the character represents an unpaired position in an RNA structure. More...
constexpr std::optional< uint8_t >	pseudoknot_id () const noexcept
	Get an identifier for a pseudoknotted interaction, where opening and closing brackets of the same type have the same id. More...

Additional Inherited Members
Static Public Attributes inherited from seqan3::alphabet_base< dot_bracket3, 3 >
static constexpr detail::min_viable_uint_t< size >	alphabet_size
	The size of the alphabet, i.e. the number of different values it can take. More...
Protected Types inherited from seqan3::alphabet_base< dot_bracket3, 3 >
using	char_type = std::conditional_t< std::same_as< char, void >, char, char >
	The char representation; conditional needed to make semi alphabet definitions legal. More...
using	rank_type = detail::min_viable_uint_t< size - 1 >
	The type of the alphabet when represented as a number (e.g. via to_rank()). More...

Detailed Description

The three letter RNA structure alphabet of the characters ".()".

The brackets denote RNA base pair interactions. Every left bracket must have a corresponding right bracket. Pseudoknots cannot be expressed in this format. A dot (.) represents a character that is not paired.

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))).

Example

#include <seqan3/alphabet/structure/dot_bracket3.hpp>
#include <seqan3/core/debug_stream.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dot_bracket3 letter{'.'_db3};
 
    letter.assign_char('(');
    seqan3::debug_stream << letter << '\n'; // prints "("
 
    letter.assign_char('F'); // Unknown characters are implicitly converted to '.'.
    seqan3::debug_stream << letter << '\n'; // prints "."
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

Member Function Documentation

is_pair_close()

constexpr bool seqan3::dot_bracket3::is_pair_close ( ) const

inlineconstexprnoexcept

Check whether the character represents a leftward interaction in an RNA structure.

Returns

True if the letter represents a leftward interaction, False otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

is_pair_open()

constexpr bool seqan3::dot_bracket3::is_pair_open ( ) const

inlineconstexprnoexcept

Check whether the character represents a rightward interaction in an RNA structure.

Returns

True if the letter represents a rightward interaction, False otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

is_unpaired()

constexpr bool seqan3::dot_bracket3::is_unpaired ( ) const

inlineconstexprnoexcept

Check whether the character represents an unpaired position in an RNA structure.

Returns

True if the letter represents an unpaired site, False otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

pseudoknot_id()

constexpr std::optional<uint8_t> seqan3::dot_bracket3::pseudoknot_id ( ) const

inlineconstexprnoexcept

Get an identifier for a pseudoknotted interaction, where opening and closing brackets of the same type have the same id.

Returns

The pseudoknot id (always 0) if alph denotes an interaction, and no value otherwise.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

Friends And Related Function Documentation

operator""_db3() [1/2]

constexpr dot_bracket3 operator""_db3 ( char const  ch )

related

The seqan3::db3 char literal.

Parameters

[in]

ch

The character to represent as dot bracket.

Returns

seqan3::dot_bracket3

You can use this char literal to assign a seqan3::dot_bracket3 character:

#include <seqan3/alphabet/structure/dot_bracket3.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dot_bracket3 letter1{'('_db3};
    auto letter2 = '('_db3;
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

operator""_db3() [2/2]

std::vector< dot_bracket3 > operator""_db3 ( const char *  str, std::size_t  len  )

related

The seqan3::db3 string literal.

Parameters

[in]	str	A pointer to the character string to assign.
[in]	len	The size of the character string to assign.

Returns

std::vector<seqan3::dot_bracket3>

You can use this string literal to easily assign to std::vector<seqan3::dot_bracket3>:

#include <seqan3/alphabet/structure/dot_bracket3.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    std::vector<seqan3::dot_bracket3> sequence1{".(..)."_db3};
    std::vector<seqan3::dot_bracket3> sequence2 = ".(..)."_db3;
    auto sequence3 = ".(..)."_db3;
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

Member Data Documentation

max_pseudoknot_depth

constexpr uint8_t seqan3::dot_bracket3::max_pseudoknot_depth {1u}

staticconstexpr

The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth.

It is the number of distinct pairs of interaction symbols the format supports. The value 1 denotes no pseudoknot support.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

---

The documentation for this class was generated from the following file:

• seqan3/alphabet/structure/dot_bracket3.hpp