Shape

Class

Shape

Stores hash value and shape for an ungapped or gapped q-gram.

Shape


GappedShape	GenericShape	OneGappedShape	SimpleShape	UngappedShape

Shape<TValue, TSpec>

Parameters

TValue	The Value type of the string the shape is applied to (e.g. Dna).
TSpec	The specializing type. Default: SimpleShape, for ungapped q-grams.

Remarks

The ValueSize of Shape is the ValueSize of TValue which is the alphabet size.

To get the span or the weight of a shape call length or weight.

Specializations

GappedShape	A fixed gapped shape.
GenericShape	A variable gapped shape.
OneGappedShape	A variable shape with one optional gap.
SimpleShape	A variable length ungapped shape (also called q-gram or k-mer).
UngappedShape	A fixed length ungapped shape (also called q-gram or k-mer).

Metafunctions

Host	Type of the object a given object depends on.
LENGTH	Number of elements in a fixed-size container.
Size	Type of an object that is suitable to hold size information.
Value	Type of the items in the container or behind an iterator.
ValueSize	Number of different values a value type object can have.
WEIGHT	Number of relevant positions in a shape.

Member Functions

Shape

Constructor

Functions

countOccurrences	Returns the number of occurrences of representative substring or a q-gram in the index text.
countOccurrencesMultiple	Returns the number of occurrences of a q-gram for every sequence of a StringSet .
createCountArray	Builds an index on a StringSet storing how often a q-gram occurs in each sequence.
createQGramIndex	Builds a q-gram index on a sequence.
createQGramIndexDirOnly	Builds the directory of a q-gram index on a sequence.
createQGramIndexSAOnly	Builds the suffix array of a q-gram index on a sequence.
getOccurrence	Returns an occurrence of the representative substring or a q-gram in the index text.
getOccurrences	Returns all occurrences of the representative substring or a q-gram in the index text.
hash	Computes a (lower) hash value for a shape applied to a sequence.
hash2	Computes an unique hash value of a shape applied to a sequence, even if the sequence is shorter than the shape span
hash2Next	Computes a unique hash value for the adjacent shape, even if it is shorter than q.
hash2Upper	Computes an upper unique hash value of a shape applied to a sequence, even if the sequence is shorter than the shape span.
hashInit	Preprocessing step of a pure hashNext loop.
hashNext	Computes the hash value for the adjacent shape.
hashUpper	Computes an upper hash value for a shape applied to a sequence.
indexShape	Shortcut for getFibre(.., QGramShape).
length	The number of items/characters.
range	Returns the suffix array interval borders of occurrences of representative substring or a q-gram in the index text.
shapeToString	Converts a given shape into a sequence of '1' (relevant position) and '0' (irrelevant position).
value	Reference to the value.
weight	Number of relevant positions in a shape.

Examples

The following code shows how one can use a gapped shape to search for the pattern "ACxA" in a reference. First we assign a form to the shape and then compute the corresponding hash value. The hash value of a string and a Shape object is unique, such that one can retrieve the string from a shape if the hash value is known.

File "shape.cpp"

1	#include <seqan/sequence.h>
2	#include <seqan/index.h>
3
4	using namespace seqan;
5
6	int main ()
7	{
8	DnaString genome = "ACGACGTGCAACGTACGACTAGCATCGGATCAGCAT";
9
10	Shape<Dna, OneGappedShape> myShape;
11	stringToShape(myShape, "1101");
12
13	// compute hash of a search pattern
14	unsigned hashedPattern = hash(myShape, "ACGA");
15	std::cout << "The hash is: " << hashedPattern << std::endl;
16
17	// compute all overlapping hashes and compare with hash of pattern
18	for (unsigned i = 0; i < length(genome) - length(myShape) + 1; ++i)
19	if (hash(myShape, begin(genome) + i) == hashedPattern)
20	std::cout << "Hit at position: " << i <<std::endl;
21
22	return 0;
23	}

The hash is: 4
Hit at position: 0
Hit at position: 14
Hit at position: 17

SeqAn - Sequence Analysis Library - www.seqan.de