A class for reading SAM files, both SAM and its binary representation BAM are supported. More...

#include <seqan3/io/sam_file/input.hpp>

Public Types
Template arguments
Exposed as member types for public access.
using	traits_type = traits_type_
	A traits type that defines aliases and template for storage of the fields.

using	selected_field_ids = selected_field_ids_
	A seqan3::fields list with the fields selected for the record.

using	valid_formats = valid_formats_
	A seqan3::type_list with the possible formats.

using	stream_char_type = char
	Character type of the stream(s).

Field types and record type
These types are relevant for record/row-based reading; they may be manipulated via the traits_type to achieve different storage behaviour.
using	sequence_type = typename traits_type::template sequence_container< typename traits_type::sequence_alphabet >
	The type of field::seq (default std::vector<seqan3::dna5>).

using	id_type = typename traits_type::template id_container< char >
	The type of field::id (default std::string by default).

using	ref_sequence_type = std::conditional_t< std::same_as< typename traits_type::ref_sequences, ref_info_not_given >, dummy_ref_type, ref_sequence_sliced_type >
	The type of field::ref_seq (default depends on construction).

using	ref_id_type = std::optional< int32_t >
	The type of field::ref_id is fixed to std::optional<int32_t>.

using	ref_offset_type = std::optional< int32_t >
	The type of field::ref_offset is fixed to a std::optional<int32_t>.

using	mapq_type = uint8_t
	The type of field::mapq is fixed to uint8_t.

using	quality_type = typename traits_type::template quality_container< typename traits_type::quality_alphabet >
	The type of field::qual (default std::vector<seqan3::phred42>).

using	flag_type = sam_flag
	The type of field::flag is fixed to seqan3::sam_flag.

using	cigar_type = std::vector< cigar >
	The type of field::cigar is fixed to std::vector<cigar>.

using	mate_type = std::tuple< ref_id_type, ref_offset_type, int32_t >
	The type of field::mate is fixed to std::tuple<ref_id_type, ref_offset_type, int32_t>).

using	header_type = sam_file_header< typename traits_type::ref_ids >
	The type of field::header_ptr (default: sam_file_header<typename traits_type::ref_ids>).

using	field_types = type_list< sequence_type, id_type, ref_id_type, ref_offset_type, std::vector< cigar >, mapq_type, quality_type, flag_type, mate_type, sam_tag_dictionary, header_type * >
	The previously defined types aggregated in a seqan3::type_list.

using	field_ids = fields< field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr >
	The subset of seqan3::field tags valid for this file; order corresponds to the types in field_types.

using	record_type = sam_record< detail::select_types_with_ids_t< field_types, field_ids, selected_field_ids >, selected_field_ids >
	The type of the record, a specialisation of seqan3::record; acts as a tuple of the selected field types.

Range associated types
The types necessary to facilitate the behaviour of an input range (used in record-wise reading).
using	value_type = record_type
	The value_type is the record_type.

using	reference = record_type &
	The reference type.

using	const_reference = void
	The const_reference type is void because files are not const-iterable.

using	size_type = size_t
	An unsigned integer type, usually std::size_t.

using	difference_type = std::make_signed_t< size_t >
	A signed integer type, usually std::ptrdiff_t.

using	iterator = detail::in_file_iterator< sam_file_input >
	The iterator type of this view (an input iterator).

using	const_iterator = void
	The const iterator type is void because files are not const-iterable.

using	sentinel = std::default_sentinel_t
	The type returned by end().

Public Member Functions
header_type &	header ()
	Access the file's header.

Constructors, destructor and assignment
	sam_file_input ()=delete
	Default constructor is explicitly deleted, you need to give a stream or file name.

	sam_file_input (sam_file_input const &)=delete
	Copy construction is explicitly deleted because you cannot have multiple access to the same file.

sam_file_input &	operator= (sam_file_input const &)=delete
	Copy assignment is explicitly deleted because you cannot have multiple access to the same file.

	sam_file_input (sam_file_input &&)=default
	Move construction is defaulted.

sam_file_input &	operator= (sam_file_input &&)=default
	Move assignment is defaulted.

	~sam_file_input ()=default
	Destructor is defaulted.

	sam_file_input (std::filesystem::path filename, selected_field_ids const &fields_tag=selected_field_ids{})
	Construct from filename.

template<input_stream stream_t, sam_file_input_format file_format> requires std::same_as<typename std::remove_reference_t<stream_t>::char_type, stream_char_type>
	sam_file_input (stream_t &stream, file_format const &format_tag, selected_field_ids const &fields_tag=selected_field_ids{})
	Construct from an existing stream and with specified format.

template<input_stream stream_t, sam_file_input_format file_format> requires std::same_as<typename std::remove_reference_t<stream_t>::char_type, stream_char_type>
	sam_file_input (stream_t &&stream, file_format const &format_tag, selected_field_ids const &fields_tag=selected_field_ids{})
	This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.

	sam_file_input (std::filesystem::path filename, typename traits_type::ref_ids &ref_ids, typename traits_type::ref_sequences &ref_sequences, selected_field_ids const &fields_tag=selected_field_ids{})
	Construct from filename and given additional reference information.

template<input_stream stream_t, sam_file_input_format file_format>
	sam_file_input (stream_t &stream, typename traits_type::ref_ids &ref_ids, typename traits_type::ref_sequences &ref_sequences, file_format const &format_tag, selected_field_ids const &fields_tag=selected_field_ids{})
	Construct from an existing stream and with specified format.

template<input_stream stream_t, sam_file_input_format file_format>
	sam_file_input (stream_t &&stream, typename traits_type::ref_ids &ref_ids, typename traits_type::ref_sequences &ref_sequences, file_format const &format_tag, selected_field_ids const &fields_tag=selected_field_ids{})
	This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.

Range interface
Provides functions for record based reading of the file.
iterator	begin ()
	Returns an iterator to current position in the file.

sentinel	end () noexcept
	Returns a sentinel for comparison with iterator.

reference	front () noexcept
	Return the record we are currently at in the file.

Public Attributes
sam_file_input_options< typename traits_type::sequence_legal_alphabet >	options
	The options are public and its members can be set directly.

Related Symbols
(Note that these are not member symbols.)
Type deduction guides
template<input_stream stream_type, sam_file_input_format file_format, detail::fields_specialisation selected_field_ids>
	sam_file_input (stream_type &&stream, file_format const &, selected_field_ids const &) -> sam_file_input< typename sam_file_input<>::traits_type, selected_field_ids, type_list< file_format > >
	Deduce selected fields, file_format, and default the rest.

template<input_stream stream_type, sam_file_input_format file_format, detail::fields_specialisation selected_field_ids>
	sam_file_input (stream_type &stream, file_format const &, selected_field_ids const &) -> sam_file_input< typename sam_file_input<>::traits_type, selected_field_ids, type_list< file_format > >
	Deduce selected fields, file_format, and default the rest.

template<input_stream stream_type, sam_file_input_format file_format>
	sam_file_input (stream_type &&stream, file_format const &) -> sam_file_input< typename sam_file_input<>::traits_type, typename sam_file_input<>::selected_field_ids, type_list< file_format > >
	Deduce file_format, and default the rest.

template<input_stream stream_type, sam_file_input_format file_format>
	sam_file_input (stream_type &stream, file_format const &) -> sam_file_input< typename sam_file_input<>::traits_type, typename sam_file_input<>::selected_field_ids, type_list< file_format > >
	Deduce file_format, and default the rest.

template<std::ranges::forward_range ref_ids_t, std::ranges::forward_range ref_sequences_t, detail::fields_specialisation selected_field_ids>
	sam_file_input (std::filesystem::path path, ref_ids_t &, ref_sequences_t &, selected_field_ids const &) -> sam_file_input< sam_file_input_default_traits< std::remove_reference_t< ref_sequences_t >, std::remove_reference_t< ref_ids_t > >, selected_field_ids, typename sam_file_input<>::valid_formats >
	Deduce selected fields, ref_sequences_t and ref_ids_t, default the rest.

template<std::ranges::forward_range ref_ids_t, std::ranges::forward_range ref_sequences_t>
	sam_file_input (std::filesystem::path path, ref_ids_t &, ref_sequences_t &) -> sam_file_input< sam_file_input_default_traits< std::remove_reference_t< ref_sequences_t >, std::remove_reference_t< ref_ids_t > >, typename sam_file_input<>::selected_field_ids, typename sam_file_input<>::valid_formats >
	Deduce ref_sequences_t and ref_ids_t, default the rest.

template<input_stream stream_type, std::ranges::forward_range ref_ids_t, std::ranges::forward_range ref_sequences_t, sam_file_input_format file_format, detail::fields_specialisation selected_field_ids>
	sam_file_input (stream_type &&stream, ref_ids_t &, ref_sequences_t &, file_format const &, selected_field_ids const &) -> sam_file_input< sam_file_input_default_traits< std::remove_reference_t< ref_sequences_t >, std::remove_reference_t< ref_ids_t > >, selected_field_ids, type_list< file_format > >
	Deduce selected fields, ref_sequences_t and ref_ids_t, and file format.

template<input_stream stream_type, std::ranges::forward_range ref_ids_t, std::ranges::forward_range ref_sequences_t, sam_file_input_format file_format, detail::fields_specialisation selected_field_ids>
	sam_file_input (stream_type &stream, ref_ids_t &, ref_sequences_t &, file_format const &, selected_field_ids const &) -> sam_file_input< sam_file_input_default_traits< std::remove_reference_t< ref_sequences_t >, std::remove_reference_t< ref_ids_t > >, selected_field_ids, type_list< file_format > >
	Deduce selected fields, ref_sequences_t and ref_ids_t, and file format.

template<input_stream stream_type, std::ranges::forward_range ref_ids_t, std::ranges::forward_range ref_sequences_t, sam_file_input_format file_format>
	sam_file_input (stream_type &&stream, ref_ids_t &, ref_sequences_t &, file_format const &) -> sam_file_input< sam_file_input_default_traits< std::remove_reference_t< ref_sequences_t >, std::remove_reference_t< ref_ids_t > >, typename sam_file_input<>::selected_field_ids, type_list< file_format > >
	Deduce ref_sequences_t and ref_ids_t, and file format.

template<input_stream stream_type, std::ranges::forward_range ref_ids_t, std::ranges::forward_range ref_sequences_t, sam_file_input_format file_format>
	sam_file_input (stream_type &stream, ref_ids_t &, ref_sequences_t &, file_format const &) -> sam_file_input< sam_file_input_default_traits< std::remove_reference_t< ref_sequences_t >, std::remove_reference_t< ref_ids_t > >, typename sam_file_input<>::selected_field_ids, type_list< file_format > >
	Deduce selected fields, ref_sequences_t and ref_ids_t, and file format.

Detailed Description

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>
class seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >

A class for reading SAM files, both SAM and its binary representation BAM are supported.

Template Parameters

traits_type	An auxiliary type that defines certain member types and constants, must model seqan3::sam_file_input_traits.
selected_field_ids	A seqan3::fields type with the list and order of desired record entries; all fields must be in seqan3::sam_file_input::field_ids.
valid_formats	A seqan3::type_list of the selectable formats (each must meet seqan3::sam_file_input_format).

Reading SAM files

Construction and specialisation

The seqan3::sam_file_input class comes with four constructors: One for construction from a file name, one for construction from an existing stream and a known format and both of the former with or without additional reference information. Constructing from a file name automatically picks the format based on the extension of the file name. Constructing from a stream can be used if you have a non-file stream, like std::cin or std::istringstream. It also comes in handy, if you cannot use file-extension based detection, but know that your input file has a certain format.

Passing reference information, e.g.

ref_ids: The name of the references, e.g. "chr1", "chr2", ...
ref_sequences: The reference sequence information in the same order as the ref_ids.

comes in handy once you want to convert the CIGAR string, read from your file, into an actual alignment. This will be covered in the section "Transforming the CIGAR information into an actual alignment".In most cases the template parameters are deduced automatically:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <filesystem>
#include <sstream>
 
#include <seqan3/io/sam_file/input.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    // Create the temporary file.
    auto tmp_file = std::filesystem::temp_directory_path() / "my.sam";
    std::ofstream tmp_stream{tmp_file};
    tmp_stream << sam_file_raw;
    tmp_stream.close();
 
    seqan3::sam_file_input fin{tmp_file}; // SAM format assumed, regular std::ifstream taken as stream
    std::filesystem::remove(tmp_file);
}

Reading from a std::istringstream:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/io/sam_file/input.hpp>
 
auto input = R"(@HD VN:1.6  SO:coordinate
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{input}, seqan3::format_sam{}};
    //                          ^ no need to specify the template arguments
}

Note that this is not the same as writing sam_file_input<> (with angle brackets). In the latter case they are explicitly set to their default values, in the former case automatic deduction happens which chooses different parameters depending on the constructor arguments. For opening from file, sam_file_input<> would have also worked, but for opening from stream it would not have.

You can define your own traits type to further customise the types used by and returned by this class, see seqan3::sam_file_input_default_traits for more details. As mentioned above, specifying at least one template parameter yourself means that you loose automatic deduction. The following is equivalent to the automatic type deduction example with a stream from above:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/io/sam_file/input.hpp>
#include <seqan3/utility/type_list/type_list.hpp>
 
auto input = R"(@HD VN:1.6  SO:coordinate
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *)";
 
int main()
{
    // The default types; you can adjust this list if you don't want to read all this data.
    using default_fields = seqan3::fields<seqan3::field::seq,
                                          seqan3::field::id,
                                          seqan3::field::ref_id,
                                          seqan3::field::ref_offset,
                                          seqan3::field::cigar,
                                          seqan3::field::mapq,
                                          seqan3::field::qual,
                                          seqan3::field::flag,
                                          seqan3::field::mate,
                                          seqan3::field::tags,
                                          seqan3::field::header_ptr>;
 
    // The expected format:
    using sam_file_input_t = seqan3::sam_file_input<seqan3::sam_file_input_default_traits<>,
                                                    default_fields,
                                                    // Which formats are allowed:
                                                    seqan3::type_list<seqan3::format_sam>>;
 
    sam_file_input_t fin{std::istringstream{input}, seqan3::format_sam{}};
}

Reading record-wise

You can iterate over this file record-wise:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/io/sam_file/input.hpp>
#include <seqan3/utility/type_list/type_list.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw}, seqan3::format_sam{}};
 
    for (auto & rec : fin)
    {
        seqan3::debug_stream << "id:  " << rec.id() << '\n';
        seqan3::debug_stream << "read sequence: " << rec.sequence() << '\n';
        seqan3::debug_stream << "mapping position: " << rec.reference_position() << '\n';
        seqan3::debug_stream << "mapping quality: " << rec.mapping_quality() << '\n';
 
        // there are more fields read on default
    }
}

In the above example, rec has the type seqan3::sam_file_input::record_type which is a specialisation of seqan3::record and behaves like a std::tuple (that's why we can access it via get). Instead of using the seqan3::field based interface on the record, you could also use std::get<0> or even std::get<dna4_vector> to retrieve the sequence, but it is not recommended, because it is more error-prone.

Note: It is important to write auto & and not just auto, otherwise you will copy the record on every iteration. Since the buffer gets "refilled" on every iteration, you can also move the data out of the record if you want to store it somewhere without copying:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
#include <utility>
#include <vector>
 
#include <seqan3/io/sam_file/input.hpp>
#include <seqan3/utility/type_list/type_list.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw}, seqan3::format_sam{}};
 
    using record_type = typename decltype(fin)::record_type;
    std::vector<record_type> records{}; // store all my records in a vector
 
    for (auto & rec : fin)
        records.push_back(std::move(rec));
}

Reading record-wise (custom fields)

If you want to skip specific fields from the record you can pass a non-empty fields trait object to the seqan3::sam_file_input constructor to select the fields that should be read from the input. For example, you may only be interested in the mapping flag and mapping quality of your SAM data to get some statistics. The following snippets demonstrate the usage of such a fields trait object.

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/io/sam_file/input.hpp>
#include <seqan3/utility/type_list/type_list.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw},
                               seqan3::format_sam{},
                               seqan3::fields<seqan3::field::flag, seqan3::field::mapq>{}};
 
    for (auto & rec : fin)
    {
        seqan3::debug_stream << "flag:  " << rec.flag() << '\n';
        seqan3::debug_stream << "mapping quality:  " << rec.mapping_quality() << '\n';
    }
}

When reading a file, all fields not present in the file (but requested implicitly or via the selected_field_ids parameter) are ignored and the respective value in the record stays empty.

Reading record-wise (decomposed records)

Instead of using get on the record, you can also use structured bindings to decompose the record into its elements. Considering the example of reading only the flag and mapping quality like before you can also write:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/io/sam_file/input.hpp>
#include <seqan3/utility/type_list/type_list.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw},
                               seqan3::format_sam{},
                               seqan3::fields<seqan3::field::flag, seqan3::field::mapq>{}};
 
    for (auto & [flag, mapq] : fin) // the order is the same as specified in fields!
    {
        seqan3::debug_stream << "flag:  " << flag << '\n';
        seqan3::debug_stream << "mapping quality:  " << mapq << '\n';
    }
}

In this case you immediately get the two elements of the tuple: flag of seqan3::sam_file_input::flag_type and mapq of seqan3::sam_file_input::mapq_type.

Note: But beware: with structured bindings you do need to get the order of elements correctly!

Transforming the CIGAR information into an actual alignment

In SeqAn, we represent an alignment as a tuple of two seqan3::aligned_sequences.The conversion from a CIGAR string to an alignment can be done with the function seqan3::alignment_from_cigar. You need to pass the reference sequence with the position the read was aligned to and the read sequence. All of it is already in the record when reading a SAM file:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <seqan3/alignment/cigar_conversion/alignment_from_cigar.hpp>
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/io/sam_file/all.hpp>
 
using namespace seqan3::literals;
 
auto sam_file_raw = R"(@HD  VN:1.6
@SQ SN:ref  LN:34
read1   41  ref 1   61  1S1M1D1M1I  ref 10  300 ACGT    !##$    AS:i:2  NM:i:7
read2   42  ref 2   62  1H7M1D1M1S2H    ref 10  300 AGGCTGNAG   !##$&'()*   xy:B:S,3,4,5
read3   43  ref 3   63  1S1M1P1M1I1M1I1D1M1S    ref 10  300 GGAGTATA    !!*+,-./
)";
 
int main()
{
    // The reference sequence might be read from a different file.
    seqan3::dna5_vector reference = "ACTGATCGAGAGGATCTAGAGGAGATCGTAGGAC"_dna5;
 
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw}, seqan3::format_sam{}};
    // You will probably read it from a file, e.g., like this:
    // seqan3::sam_file_input fin{"test.sam"};
 
    for (auto && rec : fin)
    {
        auto alignment =
            alignment_from_cigar(rec.cigar_sequence(), reference, rec.reference_position().value(), rec.sequence());
        seqan3::debug_stream << alignment << '\n';
    }
 
    // prints:
    // (ACT-,C-GT)
    // (CTGATCGAG,AGGCTGN-A)
    // (T-G-A-TC,G-AGTA-T)
}

The code will print the following:

(ACT-,C-GT)
(CTGATCGAG,AGGCTGN-A)
(T-G-A-TC,G-AGTA-T)

Views on files

Since SeqAn files are ranges, you can also create views over files. A useful example is to filter the records based on certain criteria, e.g. minimum length of the sequence field:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <ranges>
#include <sstream>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/io/sam_file/input.hpp>
#include <seqan3/utility/type_list/type_list.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw}, seqan3::format_sam{}};
 
    auto minimum_length10_filter = std::views::filter(
        [](auto const & rec)
        {
            return std::ranges::size(rec.sequence()) >= 10;
        });
 
    for (auto & rec : fin | minimum_length10_filter) // only records with sequence length >= 10 will "appear"
        seqan3::debug_stream << rec.id() << '\n';
}

End of file

You can check whether a file is at its end by comparing begin() and end() (if they are the same, the file is at its end).

Formats

We currently support reading the following formats:

Remarks: For a complete overview, take a look at SAM File

Member Typedef Documentation

◆ field_ids

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

using seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::field_ids = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>

The subset of seqan3::field tags valid for this file; order corresponds to the types in field_types.

The SAM file abstraction supports reading 10 different fields:

There exists one more field for SAM files, the seqan3::field::header_ptr, but this field is mostly used internally. Please see the seqan3::sam_file_output::header member function for details on how to access the seqan3::sam_file_header of the file.

◆ ref_id_type

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

using seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::ref_id_type = std::optional<int32_t>

The type of field::ref_id is fixed to std::optional<int32_t>.

To be consistent with the BAM format, the field::ref_id will hold the index to the actual reference information stored in the header. If a read is unmapped, the optional will remain valueless.

Attention: SeqaAn3 transforms the 1-based SAM format position into a 0-based position.

◆ ref_offset_type

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

using seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::ref_offset_type = std::optional<int32_t>

The type of field::ref_offset is fixed to a std::optional<int32_t>.

The SAM format is 1-based and a 0 in the ref_offset field indicated an unmapped read. Since we convert 1-based positions to 0-based positions when reading the SAM format, we model the ref_offset_type as a std::optional. If the input value is 0, the std::optional will remain valueless.

◆ ref_sequence_type

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

using seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::ref_sequence_type = std::conditional_t<std::same_as<typename traits_type::ref_sequences, ref_info_not_given>, dummy_ref_type, ref_sequence_sliced_type>

The type of field::ref_seq (default depends on construction).

If no reference information are given on construction, this type deduces to a sized view that throws on access (since there is nothing to access anyway). If the reference information are given, the type is deduced to a view over the given input reference sequence type such that no sequence information is copied.

Constructor & Destructor Documentation

◆ sam_file_input() [1/4]

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::sam_file_input	(	std::filesystem::path	filename,
		selected_field_ids const &	fields_tag = `selected_field_ids{}`
	)

inline

Construct from filename.

Parameters

[in]	filename	Path to the file you wish to open.
[in]	fields_tag	A seqan3::fields tag. [optional]

Exceptions

seqan3::file_open_error If the file could not be opened, e.g. non-existent, non-readable, unknown format.

In addition to the file name, you may specify a custom seqan3::fields object (e.g. seqan3::fields<seqan3::field::seq>{}) which may be easier than defining all the template parameters.

Decompression

This constructor transparently applies a decompression stream on top of the file stream in case the file is detected as being compressed. See the section on compression and decompression for more information.

◆ sam_file_input() [2/4]

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

template<input_stream stream_t, sam_file_input_format file_format>
requires std::same_as<typename std::remove_reference_t<stream_t>::char_type, stream_char_type>

seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::sam_file_input	(	stream_t &	stream,
		file_format const &	format_tag,
		selected_field_ids const &	fields_tag = `selected_field_ids{}`
	)

inline

Construct from an existing stream and with specified format.

Template Parameters

stream_t	The stream type; must model seqan3::input_stream.
file_format	The format of the file in the stream, must model seqan3::sam_file_input_format.

Parameters

[in]	stream	The stream to operate on; must be derived of std::basic_istream.
[in]	format_tag	The file format tag.
[in]	fields_tag	A seqan3::fields tag. [optional]

In addition to the stream and the format, you may specify a custom seqan3::fields object (e.g. seqan3::fields<seqan3::field::seq>{}) which may be easier than defining all the template parameters.

Decompression

This constructor transparently applies a decompression stream on top of the stream in case it is detected as being compressed. See the section on compression and decompression for more information.

◆ sam_file_input() [3/4]

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::sam_file_input	(	std::filesystem::path	filename,
		typename traits_type::ref_ids &	ref_ids,
		typename traits_type::ref_sequences &	ref_sequences,
		selected_field_ids const &	fields_tag = `selected_field_ids{}`
	)

inline

Construct from filename and given additional reference information.

Parameters

[in]	filename	Path to the file you wish to open.
[in]	ref_ids	A range containing the reference ids that correspond to the SAM/BAM file.
[in]	ref_sequences	A range containing the reference sequences that correspond to the SAM/BAM file.
[in]	fields_tag	A seqan3::fields tag. [optional]

Exceptions

seqan3::file_open_error If the file could not be opened, e.g. non-existent, non-readable, unknown format.

Reference information

The reference information given by the IDs (names) and sequences will be used to keep the record entry seqan3::sam_file_input::record_type::reference_id() consistent with the order imposed by ref_ids. This way, you can use the value of seqan3::sam_file_input::record_type::reference_id() to access the lists ref_ids and ref_sequences to retrieve the correct information for the current record.

Selecting custom fields

In addition to the file name and reference information, you may specify a custom seqan3::fields object (e.g. seqan3::fields<seqan3::field::seq>{}) which may be easier than defining all the template parameters.

Decompression

This constructor transparently applies a decompression stream on top of the file stream in case the file is detected as being compressed. See the section on compression and decompression for more information.

◆ sam_file_input() [4/4]

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

template<input_stream stream_t, sam_file_input_format file_format>

seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::sam_file_input	(	stream_t &	stream,
		typename traits_type::ref_ids &	ref_ids,
		typename traits_type::ref_sequences &	ref_sequences,
		file_format const &	format_tag,
		selected_field_ids const &	fields_tag = `selected_field_ids{}`
	)

inline

Construct from an existing stream and with specified format.

Template Parameters

stream_t	The stream type; must model seqan3::input_stream.
file_format	The format of the file in the stream; must model seqan3::sam_file_input_format.

Parameters

[in]	stream	The stream to operate on; must be derived of std::basic_istream.
[in]	ref_ids	A range containing the reference ids that correspond to the SAM/BAM file.
[in]	ref_sequences	A range containing the reference sequences that correspond to the SAM/BAM file.
[in]	format_tag	The file format tag.
[in]	fields_tag	A seqan3::fields tag. [optional]

Reference information

The reference information given by the IDs (names) and sequences will be used to keep the record entry seqan3::sam_file_input::record_type::reference_id() consistent with the order imposed by ref_ids. This way, you can use the value of seqan3::sam_file_input::record_type::reference_id() to access the lists ref_ids and ref_sequences to retrieve the correct information for the current record.

Selecting custom fields

In addition to the stream, reference information and format, you may specify a custom seqan3::fields object (e.g. seqan3::fields<seqan3::field::seq>{}) which may be easier than defining all the template parameters.

Decompression

This constructor transparently applies a decompression stream on top of the stream in case it is detected as being compressed. See the section on compression and decompression for more information.

Member Function Documentation

◆ begin()

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

iterator seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::begin ( )

inline

Returns an iterator to current position in the file.

Returns: An iterator pointing to the current position in the file.

Exceptions

seqan3::format_error

Equals end() if the file is at end.

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/io/sam_file/input.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw}, seqan3::format_sam{}};
 
    auto it = fin.begin();
 
    // the following are equivalent:
    auto & rec0 = *it;
    auto & rec1 = fin.front();
    std::cout << std::boolalpha << (rec0.id() == rec1.id()) << '\n'; // true
    // Note: both become invalid after incrementing "it"!
}

Complexity

Constant.

Exceptions

Throws seqan3::format_error if the first record could not be read into the buffer.

◆ end()

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

sentinel seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::end ( )

inlinenoexcept

Returns a sentinel for comparison with iterator.

Returns: Iterator to the first element.

This element acts as a placeholder; attempting to dereference it results in undefined behaviour.

Complexity

Constant.

Exceptions

No-throw guarantee.

◆ front()

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

reference seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::front ( )

inlinenoexcept

Return the record we are currently at in the file.

Returns: A reference to the currently buffered record.

This function returns a reference to the currently buffered record, it is identical to dereferencing begin(), and begin also always points to the current record on single pass input ranges:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/io/sam_file/input.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw}, seqan3::format_sam{}};
 
    auto it = fin.begin();
 
    // the following are equivalent:
    auto & rec0 = *it;
    auto & rec1 = fin.front();
    std::cout << std::boolalpha << (rec0.id() == rec1.id()) << '\n'; // true
    // Note: both become invalid after incrementing "it"!
}

In most situations using the iterator interface or a range-based for-loop are preferable to using front(), because you can only move to the next record via the iterator.

In any case, don't forget the reference! If you want to save the data from the record elsewhere, use move:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/io/sam_file/input.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw}, seqan3::format_sam{}};
 
    auto rec = std::move(fin.front()); // rec now stores the data permanently
}

Complexity

Constant.

Exceptions

No-throw guarantee.

◆ header()

template<sam_file_input_traits traits_type_ = sam_file_input_default_traits<>, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::ref_id, field::ref_offset, field::cigar, field::mapq, field::qual, field::flag, field::mate, field::tags, field::header_ptr>, detail::type_list_of_sam_file_input_formats valid_formats_ = type_list<format_sam, format_bam>>

header_type & seqan3::sam_file_input< traits_type_, selected_field_ids_, valid_formats_ >::header ( )

inline

Access the file's header.

You can access the header directly after the construction with reference information of the file object.

Example

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
 
#include <sstream>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/io/sam_file/input.hpp>
#include <seqan3/utility/type_list/type_list.hpp>
 
auto sam_file_raw = R"(@HD  VN:1.6  SO:coordinate   GO:none
@SQ SN:ref  LN:45
r001    99  ref 7   30  8M2I4M1D3M  =   37  39  TTAGATAAAGGATACTG   *
r003    0   ref 29  30  5S6M    *   0   0   GCCTAAGCTAA *   SA:Z:ref,29,-,6H5M,17,0;
r003    2064    ref 29  17  6H5M    *   0   0   TAGGC   *   SA:Z:ref,9,+,5S6M,30,1;
r001    147 ref 237 30  9M  =   7   -39 CAGCGGCAT   *   NM:i:1
)";
 
int main()
{
    seqan3::sam_file_input fin{std::istringstream{sam_file_raw}, seqan3::format_sam{}};
 
    // access the header information
    seqan3::debug_stream << fin.header().format_version << '\n'; // 1.6
    seqan3::debug_stream << fin.header().ref_dict << '\n'; // [(ref,(45,))] (this only works with seqan3::debug_stream!)
}

See also: seqan3::sam_file_header

The documentation for this class was generated from the following file:

sam_file/input.hpp

Public Types

Public Member Functions

Public Attributes

Related Symbols

Detailed Description

Reading SAM files

Construction and specialisation

Reading record-wise

Reading record-wise (custom fields)

Reading record-wise (decomposed records)

Transforming the CIGAR information into an actual alignment

Views on files

End of file

Formats

Member Typedef Documentation

◆ field_ids

◆ ref_id_type

◆ ref_offset_type

◆ ref_sequence_type

Constructor & Destructor Documentation

◆ sam_file_input() [1/4]

Decompression

◆ sam_file_input() [2/4]

Decompression

◆ sam_file_input() [3/4]

Reference information

Selecting custom fields

Decompression

◆ sam_file_input() [4/4]

Reference information

Selecting custom fields

Decompression

Member Function Documentation

◆ begin()

Complexity

Exceptions

◆ end()

Complexity

Exceptions

◆ front()

Complexity

Exceptions

◆ header()

Example