Views are "lazy range combinators" that offer modified views onto other ranges. More...

Collaboration diagram for Views:

Files
file	adaptor_base.hpp
	Provides seqan3::detail::adaptor_base and seqan3::detail::combined_adaptor.

file	adaptor_for_view_without_args.hpp
	Provides seqan3::detail::adaptor_for_view_without_args.

file	adaptor_from_functor.hpp
	Provides seqan3::detail::adaptor_from_functor.

Classes
class	seqan3::views::deep< underlying_adaptor_t >
	A wrapper type around an existing view adaptor that enables "deep view" behaviour for that view. More...

Variables
constexpr auto	seqan3::views::chunk = ::ranges::views::chunk
	A chunk view. More...

template<auto index>
constexpr auto	seqan3::views::get = views::elements<index>
	A view calling `get` on each element in a range. More...

constexpr auto	seqan3::views::istreambuf
	A view factory that returns a view over the stream buffer of an input stream. More...

constexpr auto	seqan3::views::join = ::ranges::views::join
	A join view. More...

constexpr auto	seqan3::views::join_with = ::ranges::views::join
	A join view, please use std::views::join if you don't need a separator. More...

constexpr auto	seqan3::views::persist = detail::persist_fn{}
	A view adaptor that wraps rvalue references of non-views. More...

constexpr auto	seqan3::views::take_line = detail::take_line
	A view adaptor that returns a single line from the underlying range. More...

constexpr auto	seqan3::views::take_line_or_throw = detail::take_line_or_throw
	A view adaptor that returns a single line from the underlying range (throws if there is no end-of-line). More...

constexpr auto	seqan3::views::take_until_and_consume = detail::take_until_and_consume
	A view adaptor that returns elements from the underlying range until the functor evaluates to true (or the end of the underlying range is reached and consumes the end in single-pass ranges). More...

constexpr auto	seqan3::views::take_until_or_throw_and_consume = detail::take_until_fn<true, true>{}
	A view adaptor that returns elements from the underlying range until the functor evaluates to true (throws if the end of the underlying range is reached and consumes the end in single-pass ranges). More...

constexpr auto	seqan3::views::to
	A to view. More...

constexpr auto	seqan3::views::zip = ::ranges::views::zip
	A zip view. More...

Alphabet related views
template<alphabet alphabet_type>
auto const	seqan3::views::char_to
	A view over an alphabet, given a range of characters. More...

auto const	seqan3::views::complement
	A view that converts a range of nucleotides to their complement. More...

template<typename alphabet_type >
auto const	seqan3::views::rank_to
	A view over an alphabet, given a range of ranks. More...

auto const	seqan3::views::to_char
	A view that calls seqan3::to_char() on each element in the input range. More...

auto const	seqan3::views::to_rank
	A view that calls seqan3::to_rank() on each element in the input range. More...

constexpr auto	seqan3::views::translate_single
	A view that translates nucleotide into aminoacid alphabet for one of the six frames. More...

constexpr auto	seqan3::views::translate
	A view that translates nucleotide into aminoacid alphabet with 1, 2, 3 or 6 frames. More...

constexpr auto	seqan3::views::translate_join
	A view that translates nucleotide into aminoacid alphabet with 1, 2, 3 or 6 frames. Input and output range are always two-dimensional. More...

constexpr auto	seqan3::views::trim_quality
	A view that does quality-threshold trimming on a range of seqan3::quality_alphabet. More...

constexpr auto	seqan3::views::kmer_hash
	Computes hash values for each position of a range via a given shape. More...

constexpr auto	seqan3::views::minimiser_hash
	Computes minimisers for a range with a given shape, window size and seed. More...

General purpose views
constexpr auto	seqan3::views::take
	A view adaptor that returns the first `size` elements from the underlying range (or less if the underlying range is shorter). More...

constexpr auto	seqan3::views::async_input_buffer
	A view adapter that returns a concurrent-queue-like view over the underlying range. More...

constexpr auto	seqan3::views::as_const
	A view that provides only `const &` to elements of the underlying range. More...

constexpr auto	seqan3::views::drop
	A view adaptor that returns all elements after n from the underlying range (or an empty range if the underlying range is shorter). More...

auto const	seqan3::views::move
	A view that turns lvalue-references into rvalue-references. More...

auto const	seqan3::views::to_lower
	A view that calls seqan3::to_lower() on each element in the input range. More...

auto const	seqan3::views::to_upper
	A view that calls seqan3::to_upper() on each element in the input range. More...

constexpr auto	seqan3::views::minimiser
	Computes minimisers for a range of comparable values. A minimiser is the smallest value in a window. More...

template<typename out_t >
constexpr auto	seqan3::views::convert
	A view that converts each element in the input range (implicitly or via `static_cast`). More...

template<auto index>
constexpr auto	seqan3::views::elements
	A view calling `get` on each element in a range. More...

constexpr auto	seqan3::views::enforce_random_access
	A view adaptor that converts a pseudo random access range to a std::ranges::random_access_range. More...

constexpr auto	seqan3::views::interleave
	A view that interleaves a given range into another range at regular intervals. More...

constexpr auto	seqan3::views::pairwise_combine
	A view adaptor that generates all pairwise combinations of the elements of the underlying range. More...

constexpr detail::repeat_fn	seqan3::views::repeat
	A view factory that repeats a given value infinitely. More...

constexpr auto	seqan3::views::repeat_n
	A view factory that repeats a given value `n` times. More...

constexpr auto	seqan3::views::single_pass_input
	A view adapter that decays most of the range properties and adds single pass behavior. More...

constexpr auto	seqan3::views::slice
	A view adaptor that returns a half-open interval on the underlying range. More...

constexpr auto	seqan3::views::type_reduce
	A view adaptor that behaves like std::views::all, but type erases certain ranges. More...

Detailed Descriptionno-api

Views are "lazy range combinators" that offer modified views onto other ranges.

SeqAn makes heavy use of views as defined in the Ranges Technical Specification. From the original documentation: "A view is a lightweight wrapper that presents a view of an underlying sequence of elements in some custom way without mutating or copying it. Views are cheap to create and copy, and have non-owning reference semantics. [...] The big advantage of ranges over iterators is their composability. They permit a functional style of programming where data is manipulated by passing it through a series of combinators. In addition, the combinators can be lazy, only doing work when the answer is requested, and purely functional, without mutating the original data. This makes it easier to reason about your code, especially when writing concurrent programs."

See the range module for how views relate to containers and decorators.

Most views provided by SeqAn are specific to biological operations, like seqan3::views::trim_quality which trims sequences based on the quality or seqan3::views::complement which generates the complement of a nucleotide sequence. But SeqAn also provides some general purpose views.

Namespaces

All views from the range-v3 libary are available in the namespace ranges::view.
All SeqAn views are available in the namespace seqan3::views.

Example

Functional and pipe notations:

#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/views/complement.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dna4_vector vec{"ACGGTC"_dna4};
 
    // these are synonymous:
    auto vec_view1 = vec | seqan3::views::complement;
    auto vec_view2 = seqan3::views::complement(vec);
 
    // both views "behave" like a collection of the elements 'T', 'G', 'C', 'C', 'A', 'G'
    // but can be copied cheaply et cetera
}

Re-transform into a distinct container:

#include <seqan3/std/ranges>
 
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/views/complement.hpp>
#include <seqan3/utility/views/to.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dna4_vector vec{"ACGGTC"_dna4};
    auto vec_view2 = seqan3::views::complement(vec);
 
    // re-convert to container
    seqan3::dna4_vector complemented = vec_view2 | seqan3::views::to<seqan3::dna4_vector>;
    assert(complemented == "TGCCAG"_dna4);
 
    // also possible in one step
    seqan3::dna4_vector reversed = vec | std::views::reverse | seqan3::views::to<seqan3::dna4_vector>;
    assert(reversed == "CTGGCA"_dna4);
}

Composability:

#include <seqan3/std/ranges>
 
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/views/complement.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dna4_vector vec{"ACGGTC"_dna4};
    // views can be composed iteratively
    auto vec_view3 = vec | std::views::reverse;
    auto vec_view4 = vec_view3 | seqan3::views::complement;
 
    // or in one line similar to the unix command line
    auto vec_view5 = vec | seqan3::views::complement | std::views::reverse;
 
    // vec_view4 and vec_view5 are the reverse complement of "ACGGTC": "GACCGT"
}

Views vs view adaptors

When talking about views, two different entities are often conflated:

the view (this is the type that is a range and meets std::ranges::view; it is what we refer to with auto vec_view above)
the view adaptor (this is the functor that returns the actual view based on it's parameters, including the underlying range; in the above example views::reverse and views::complement are view adaptors)

The view adaptor also facilitates the piping behaviour. It is the only entity that is publicly documented and the actual view type (the range type returned by the adaptor) is considered implementation defined. The properties of the returned range are however specified and documented as part of the adaptor, see below.

_{An exception to this rule are views that don't work on an underlying range and can only be placed at the beginning of a pipe of operations; they do not need an adaptor, because their constructor is sufficient. This is not relevant for the documentation, though, we always document views::foo, independent of whether views::foo is the adaptor that returns the "foo type" or whether views::foo is the "foo type".}

View properties

There are three view properties that are documented for a view, only if that view fulfills them:

Source-only views: Most views operate on an underlying range and return a (modified) range, i.e. they can be placed at the beginning, middle or end of a "pipe" of view operations. However, some views are limited to being at the front ("source"), e.g. std::views::single, ranges::view::concat and std::views::ints. These views are marked as "source-only" and have no urng_t column in the second table.

Sink-only views: The opposite of a source-only view. It can only be placed at the end of a pipe, i.e. it operates on views, but does not actually return a range (has no rrng_t column in the second table).

Deep views: Some views are declared as "deeps views". This means, that in case they are given a range-of-range as input (as opposed to just a range), they will apply their transformation on the innermost range (instead of the outermost range which would be default). Most alphabet-based transformations are defined as deep, but you can use seqan3::views::deep to make any view (adaptor) deep. See seqan3::views::deep for more details.

For all views the following are documented:

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	[required] (usually)	[preserved\|lost\|guaranteed] (usually preserved)
std::ranges::forward_range	[required] (or not)	[preserved\|lost\|guaranteed]
std::ranges::bidirectional_range	[required] (or not)	[preserved\|lost\|guaranteed]
std::ranges::random_access_range	[required] (or not)	[preserved\|lost\|guaranteed]
std::ranges::contiguous_range	[required] (or not)	[preserved\|lost\|guaranteed] (usually lost)

std::ranges::viewable_range	[required] (usually)	[preserved\|lost\|guaranteed] (usually guaranteed)
std::ranges::view	[required] (or not)	[preserved\|lost\|guaranteed] (usually guaranteed)
std::ranges::sized_range	[required] (or not)	[preserved\|lost\|guaranteed]
std::ranges::common_range	[required] (or not)	[preserved\|lost\|guaranteed]
std::ranges::output_range	[required] (or not)	[preserved\|lost\|guaranteed]
seqan3::const_iterable_range	[required] (or not)	[preserved\|lost]

std::ranges::range_reference_t	optionally a type or concept	optionally a type or concept

Underlying range requirements: All view adaptors that are not source-only make certain assumptions about their underlying range. The most basic assumption is that the range satisfies std::ranges::input_range, but many have stronger requirements, e.g. std::ranges::random_access_range. The concepts in the first block all build up on each other, i.e. requiring one implies requiring those above; the other concepts are mostly independent of each other. Most views also require that the underlying range satisfy std::ranges::viewable_range which means they don't accept temporary range objects other than views (because they are cheap to copy). Note that these being requirements means that they are the minimal set of properties assumed. Views may very well make use of stronger properties if available.

Return range guarantees: All view adaptors that are not sink-only return a range that meets at least std::ranges::input_range and also std::ranges::view (and conversely also std::ranges::viewable_range, because all views are viewable). Most views also preserve stronger properties, e.g. std::ranges::random_access_range, but this depends on the view. Some views may add properties not present on the input range.

preserved in this context means that the returned range satisfies this concept if it is also satisfied by the underlying range.
lost means that this concept is never satisfied by the returned range, independent of whether the underlying range supports it.
guaranteed means that this concept is always satisfied by the returned range, independent of whether the underlying range supports it.

Underlying range's reference type: The reference type is the type the elements of the underlying range are accessed by (since dereferencing an iterator or calling operator[] returns the reference type). The reference type may or may not actually contain a & (see below). For many SeqAn specific views additional concept requirements are defined for the input range's reference type, e.g. seqan3::views::complement can only operate on ranges whose elements are nucleotides (meet seqan3::nucleotide_alphabet_check). In some case the type may even be a specific type or the result of a type trait.

Returned range's reference type: Conversely certain views make guarantees on the concepts satisfied by the return range's reference type or even always have a fixed type, e.g. seqan3::views::complement operates on nucleotides and of course also returns nucleotides and "std::ranges::range_reference_t<urng_t>" would imply that the reference type is the same. However, and this is important to note, the reference type of seqan3::views::complement has any actual & removed from the underlying ranges' reference type (if originally present), this goes hand-in-hand with std::ranges::output_range being lost → original elements cannot be written to through this view. This is because new elements are being generated. Other views like views::reverse also preserve the & (if originally present), because the elements in the return view still point to the elements in the original range (just in different order). This has the effect that through some combinations of views you can modify the elements in the original range (if all views in the pipe preserve std::ranges::output_range), but through others you can't.

See also: https://ericniebler.github.io/range-v3/index.html#range-views

Variable Documentation

◆ as_const

constexpr auto seqan3::views::as_const

no-apiinlineconstexpr

A view that provides only const & to elements of the underlying range.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of const-protected elements.

Header File

#include <seqan3/range/views/as_const.hpp>

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		preserved

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved
std::semiregular		preserved

std::ranges::range_reference_t		`t &` -> `t const &` but `t` -> `t`

See the views submodule documentation for detailed descriptions of the view properties.

Example

#include <seqan3/core/platform.hpp>
 
#ifdef SEQAN3_DEPRECATED_310
#pragma GCC diagnostic push
#pragma GCC diagnostic ignored "-Wdeprecated-declarations"
 
#include <seqan3/std/ranges>
#include <string>
 
#include <seqan3/range/views/as_const.hpp>
 
template <std::ranges::random_access_range rng_t>
void foobar(rng_t const & range)
{
    range[0] = 'A';
}
 
int main()
{
    std::string s{"CCC"};
    auto v0 = std::views::all(s);
    foobar(v0); // this is valid and will update s to "ACC"
                // because const-ness of view does not protect elements
 
    auto v1 = seqan3::views::as_const(s);
    // foobar(v1); // this is invalid, views::as_const protects elements
}
 
#pragma GCC diagnostic pop
#endif // SEQAN3_DEPRECATED_310

Deprecated:: No alternative.

◆ async_input_buffer

constexpr auto seqan3::views::async_input_buffer

experimental-apiinlineconstexpr

A view adapter that returns a concurrent-queue-like view over the underlying range.

Template Parameters

urng_t The type of the range being processed. See below for requirements.

Parameters

[in,out]	urange	The range being processed.
[in]	buffer_size	Size of the buffer. Choose the size (> 0) depending on the expected work per element.

Returns: A view that pre-fetches elements from the underlying range and provides a thread-safe interface. See below for the properties of the returned range.

Header File

#include <seqan3/io/views/async_input_buffer.hpp>

Summary

This view spawns a background thread that pre-fetches elements from the underlying range and stores them in a concurrent queue. Iterating over this view then pops elements out of the queue and returns them. This is primarily useful if dereferencing/incrementing the iterator of the underlying range is expensive, e.g. with SeqAn files which lazily perform I/O.

Another advantage of this view is that multiple iterators can be created that are safe to iterate individually, even from different threads, i.e. you can use multiple threads to iterate safely over a single-pass input view with the added benefit of background pre-fetching.

In technical terms: this view facilitates a single-producer, multi-consumer design; it's a range interface over a concurrent queue.

Size of the buffer

The buffer_size parameter should be chosen depending on the expected work per element, e.g. if the underlying range is an input file over short reads, a buffer size of 100 or 1000 could be beneficial; if on the other hand the file contains genome-sized sequences, it would be better to buffer only a single sequence (buffering 100 sequences would result in the entire file being preloaded and likely consuming significant memory).

Range consumption

This view always moves elements from the underlying range into its buffer which means that the elements in the underlying range will be invalidated! For underlying ranges that are single-pass, this makes no difference, but it might be unexpected for multi-pass ranges (std::ranges::forward_range).

Typically this adaptor is used when you want to consume the entire underlying range. Destructing this view before all elements have been read will also stop the thread that moves object from the underlying range. In general, it is not safe to access the underlying range in other contexts once it has been passed to seqan3::views::async_input_buffer.

Note that in addition to the buffer of the view, every iterator has its own one-element-buffer. Dereferencing the iterator returns a reference to the element in the buffer, usually you will want to move this element out of the buffer with std::move std::ranges::iter_move. Incrementing the iterator refills the buffer from the queue inside the view (which in turn is then refilled from the underlying range).

View properties

concepts and reference type	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		lost
std::ranges::bidirectional_range		lost
std::ranges::random_access_range		lost
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		lost
std::ranges::common_range		lost
std::ranges::output_range		lost
seqan3::const_iterable_range		lost

std::ranges::range_reference_t		`std::ranges::range_value_t<urng_t> &`

std::iterator_traits ::iterator_category		none

See the views submodule documentation for detailed descriptions of the view properties.

Thread safety

The following operations are thread-safe:

calling .begin() and .end() on the view returned by this adaptor;
calling operators on the different iterator objects.

Calling operators on the same iterator object from different threads is not safe, i.e. you can pass the view to different threads by reference, and have each of those threads call begin() on the view and then perform operations (dereference, increment...) on that iterator from the respective thread; but you cannot call begin() in a parent thread, pass the iterator to different threads and operate on that concurrently.

Example

#include <cstdlib>                              // std::rand
#include <future>                               // std::async
#include <string>                               // std::string
 
#include <seqan3/core/debug_stream.hpp>         // seqan3::debug_stream
#include <seqan3/io/sequence_file/input.hpp>    // seqan3::sequence_file_input
#include <seqan3/io/views/async_input_buffer.hpp>   // seqan3::views::async_input_buffer
 
std::string fasta_file =
R"(> seq1
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq2
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq3
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq4
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq5
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq6
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq7
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq8
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq9
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq10
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq11
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
> seq12
ACGACTACGACGATCATCGATCGATCGATCGATCGATCGATCGATCGTACTACGATCGATCG
)";
 
int main()
{
    // initialise random number generator, only needed for demonstration purposes
    std::srand(std::time(nullptr));
 
    // create an input file from the string above
    seqan3::sequence_file_input fin{std::istringstream{fasta_file}, seqan3::format_fasta{}};
 
    // create the async buffer around the input file
    // spawns a background thread that tries to keep four records in the buffer
    auto v = fin | seqan3::views::async_input_buffer(4);
 
    // create a lambda function that iterates over the async buffer when called
    // (the buffer gets dynamically refilled as soon as possible)
    auto worker = [&v] ()
    {
        for (auto & record : v)
        {
            // pretend we are doing some work
            std::this_thread::sleep_for(std::chrono::milliseconds(std::rand() % 1000));
            // print current thread and sequence ID
            seqan3::debug_stream << "Thread: " << std::this_thread::get_id()             << '\t'
                                 << "Seq:    " << record.id() << '\n';
 
        }
    };
 
    // launch two threads and pass the lambda function to both
    auto f0 = std::async(std::launch::async, worker);
    auto f1 = std::async(std::launch::async, worker);
}

Running the snippet could yield the following output:

Thread: 0x80116bf00     Seq:    seq2
Thread: 0x80116bf00     Seq:    seq3
Thread: 0x80116ba00     Seq:    seq1
Thread: 0x80116bf00     Seq:    seq4
Thread: 0x80116bf00     Seq:    seq6
Thread: 0x80116ba00     Seq:    seq5
Thread: 0x80116bf00     Seq:    seq7
Thread: 0x80116ba00     Seq:    seq8
Thread: 0x80116bf00     Seq:    seq9
Thread: 0x80116bf00     Seq:    seq11
Thread: 0x80116bf00     Seq:    seq12
Thread: 0x80116ba00     Seq:    seq10

This shows that indeed elements from the underlying range are processed non-sequentially, that there are two threads and that work is "balanced" between them (one thread processed more element than the other, because its "work" per item happened to be smaller).

Note that you might encounter jumbled output if by chance two threads write to the stream at the exact same time.

If you remove the line starting with auto f1 = ... you will get sequential processing:

Thread: 0x80116aa00     Seq:    seq1
Thread: 0x80116aa00     Seq:    seq2
Thread: 0x80116aa00     Seq:    seq3
Thread: 0x80116aa00     Seq:    seq4
Thread: 0x80116aa00     Seq:    seq5
Thread: 0x80116aa00     Seq:    seq6
Thread: 0x80116aa00     Seq:    seq7
Thread: 0x80116aa00     Seq:    seq8
Thread: 0x80116aa00     Seq:    seq9
Thread: 0x80116aa00     Seq:    seq10
Thread: 0x80116aa00     Seq:    seq11
Thread: 0x80116aa00     Seq:    seq12

Note that even if you have a single processing thread, using this view can still improve performance measurably, because loading of the elements into the buffer (which reads input from disk) happens in a background thread.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ char_to

template<alphabet alphabet_type>

auto const seqan3::views::char_to

stable-apiinline

A view over an alphabet, given a range of characters.

Template Parameters

urng_t	The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]
alphabet_t	The alphabet to convert to; must satisfy seqan3::alphabet.

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of converted elements. See below for the properties of the returned range.

Header File

#include <seqan3/alphabet/views/char_to.hpp>

View properties

This view is a deep view Given a range-of-range as input (as opposed to just a range), it will apply the transformation on the innermost range (instead of the outermost range).

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::alphabet_char_t<alphabet_t>	`alphabet_t`

See the views submodule documentation for detailed descriptions of the view properties.

Example

#include <string>
 
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/nucleotide/dna5.hpp>
#include <seqan3/alphabet/views/char_to.hpp>
 
int main()
{
    std::string s{"ACTTTGATAN"};
    auto v1 = s | seqan3::views::char_to<seqan3::dna4>; // == "ACTTTGATAA"_dna4
    auto v2 = s | seqan3::views::char_to<seqan3::dna5>; // == "ACTTTGATAN"_dna5
}

This entity is stable. Since version 3.1.

◆ chunk

constexpr auto seqan3::views::chunk = ::ranges::views::chunk

no-apiinlineconstexpr

A chunk view.

This entity is not part of the SeqAn API. Do not rely on it in your applications. This is currently range-v3's chunk implementation.

◆ complement

auto const seqan3::views::complement

stable-apiinline

A view that converts a range of nucleotides to their complement.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of converted elements. See below for the properties of the returned range.

Header File

#include <seqan3/alphabet/views/complement.hpp>

Calls seqan3::nucleotide_alphabet::complement() on every element of the input range.

View properties

This view is a deep view Given a range-of-range as input (as opposed to just a range), it will apply the transformation on the innermost range (instead of the outermost range).

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::nucleotide_alphabet	std::remove_reference_t<std::ranges::range_reference_t<urng_t>>

See the views submodule documentation for detailed descriptions of the view properties.

Example

#include <seqan3/std/ranges>
 
#include <seqan3/alphabet/nucleotide/dna5.hpp>
#include <seqan3/alphabet/views/complement.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dna5_vector foo{"ACGTA"_dna5};
 
    // pipe notation
    auto v = foo | seqan3::views::complement;                        // == "TGCAT"
 
    // function notation
    auto v2(seqan3::views::complement(foo));                         // == "TGCAT"
 
    // generate the reverse complement:
    auto v3 = foo | seqan3::views::complement | std::views::reverse; // == "TACGT"
}

This entity is stable. Since version 3.1.

◆ convert

template<typename out_t >

constexpr auto seqan3::views::convert

no-apiinlineconstexpr

A view that converts each element in the input range (implicitly or via static_cast).

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of converted elements. See below for the properties of the returned range.

Header File

#include <seqan3/utility/views/convert.hpp>

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost¹

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost¹
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::convertible_to<out_t>	`out_t`

¹ These are preserved if out_t is the same as std::ranges::range_reference_t<urng_t>, i.e. no conversion takes place.

See the views submodule documentation for detailed descriptions of the view properties.

Example

Convert from int to bool:

#include <seqan3/std/ranges>
#include <vector>
 
#include <seqan3/alphabet/nucleotide/dna15.hpp>
#include <seqan3/alphabet/nucleotide/dna5.hpp>
#include <seqan3/utility/views/convert.hpp>
#include <seqan3/utility/views/to.hpp>
 
int main()
{
    // convert from int to bool
    std::vector<int>  vec{7, 5, 0, 5, 0, 0, 4, 8, -3};
 
    // pipe notation
    auto v = vec | seqan3::views::convert<bool>; // == [1, 1, 0, 1, 0, 0, 1, 1, 1];
 
    // function notation and immediate conversion to vector again
    auto v2 = seqan3::views::convert<bool>(vec) | seqan3::views::to<std::vector<bool>>;
 
    // combinability
    auto v3 = vec | seqan3::views::convert<bool> | std::views::reverse; // == [1, 1, 1, 0, 0, 1, 0, 1, 1];
}

Convert from seqan3::dna15 to seqan3::dna5:

#include <seqan3/alphabet/nucleotide/dna15.hpp>
#include <seqan3/alphabet/nucleotide/dna5.hpp>
#include <seqan3/utility/views/convert.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dna15_vector vec2{"ACYGTN"_dna15};
    auto v4 = vec2 | seqan3::views::convert<seqan3::dna5>; // == "ACNGTN"_dna5
}

This entity is not part of the SeqAn API. Do not rely on it in your applications.

◆ drop

constexpr auto seqan3::views::drop

no-apiinlineconstexpr

A view adaptor that returns all elements after n from the underlying range (or an empty range if the underlying range is shorter).

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in]	urange	The range being processed. [parameter is omitted in pipe notation]
[in]	drop_size	The number of elements to drop from the beginning.

Returns: All elements of the underlying range after the first drop_size.

Header File

#include <seqan3/range/views/drop.hpp>

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		preserved

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		preserved
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t		std::ranges::range_reference_t<urng_t>

See the views submodule documentation for detailed descriptions of the view properties.

Return type

`urng_t` (underlying range type)	`rrng_t` (returned range type)
`std::basic_string const &` or `std::basic_string_view`	`std::basic_string_view`
`std::ranges::borrowed_range && std::ranges::sized_range && std::ranges::contiguous_range`	`std::span`
`std::ranges::borrowed_range && std::ranges::sized_range && std::ranges::random_access_range`	`std::ranges::subrange`
else	implementation defined type

The adaptor is different from std::views::drop in that it performs type erasure for some underlying ranges. It returns exactly the type specified above.

Complexity

Construction time of the returned view is in if the underlying range models at least std::ranges::random_access_range and std::ranges::sized_range; otherwise in $O(drop\_size)$ .

Example

#include <seqan3/core/platform.hpp>
 
#ifdef SEQAN3_DEPRECATED_310
#pragma GCC diagnostic push
#pragma GCC diagnostic ignored "-Wdeprecated-declarations"
#include <string>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/range/views/drop.hpp>          // provides views::drop
#include <seqan3/std/ranges>                    // provides std::views::reverse
 
int main()
{
    std::string s{"foobar"};
    auto v = s | seqan3::views::drop(3);
    seqan3::debug_stream << v << '\n';          // "bar"
 
    auto v2 = s | std::views::reverse | seqan3::views::drop(3);
    seqan3::debug_stream << v2 << '\n';         // "oof"
}
#pragma GCC diagnostic pop
#endif // SEQAN3_DEPRECATED_310

Deprecated:: Use std::views::drop or seqan3::views::type_reduce | std::views::drop.

◆ elements

template<auto index>

constexpr auto seqan3::views::elements

experimental-apiinlineconstexpr

A view calling get on each element in a range.

Template Parameters

size_t	The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]
index	The index to get.

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of elements where every element is the result of calling get<index> on the underlying element. See below for the properties of the returned range.

See also: https://en.cppreference.com/w/cpp/ranges/elements_view

Header File

#include <seqan3/utility/views/elements.hpp>

This view may be used instead of std::view::elements when the underlying range contains seqan3 types, e.g. seqan3::qualified.

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	preserved
std::ranges::view		preserved
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		preserved
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::tuple_like	std::tuple_element_t<index, std::ranges::range_reference_t<urng_t>>

See the views submodule documentation for detailed descriptions of the view properties.

Example

#include <vector>
 
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/quality/aliases.hpp> // includes seqan3::dna4q
#include <seqan3/alphabet/quality/phred42.hpp>
#include <seqan3/alphabet/views/to_char.hpp>
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/utility/views/elements.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    // Create a vector of dna4 quality composite alphabet.
    std::vector<seqan3::dna4q> qv{{'A'_dna4, '0'_phred42},
                                  {'C'_dna4, '1'_phred42},
                                  {'G'_dna4, '2'_phred42},
                                  {'T'_dna4, '3'_phred42}};
 
    seqan3::debug_stream << (qv | seqan3::views::elements<0> | seqan3::views::to_char) << '\n'; // Prints [A,C,G,T]
    seqan3::debug_stream << (qv | seqan3::views::elements<1> | seqan3::views::to_char) << '\n'; // Prints [!,",#,$]
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ enforce_random_access

constexpr auto seqan3::views::enforce_random_access

experimental-apiinlineconstexpr

A view adaptor that converts a pseudo random access range to a std::ranges::random_access_range.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A std::ranges::random_access_range over the given range.

Header File

#include <seqan3/utility/views/enforce_random_access.hpp>

A pseudo random access range is a range whose iterator typically defines all the interfaces necessary to allow random access, but cannot guarantee accessing an arbitrary element in constant time. Thus, the highest category it can support by default is std::ranges::bidirectional_range. However, for many of these pseudo random access ranges better algorithms and data structures with sub-linear runtime complexities can be used (for example logarithmic time complexity). To enforce the faster behaviour of the range in a generic range-based context you can use this range adaptor, which will return a range that models std::ranges::random_access_range. Note, that this does not mean that the complexity of accessing an arbitrary element of the adapted range improves to constant time, but merely all syntactical requirements are fulfilled including the iterator tag.

View properties

range concepts and reference_t	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	guaranteed
std::ranges::forward_range	required	guaranteed
std::ranges::bidirectional_range		guaranteed
std::ranges::random_access_range		guaranteed
std::ranges::contiguous_range		preserved

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		preserved
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t		std::ranges::range_reference_t<urng_t>

See the views submodule documentation for detailed descriptions of the view properties.

This adaptor requires that the underlying range models either std::ranges::random_access_range or seqan3::pseudo_random_access_range.

Return type

`urng_t` (underlying range type)	`rrng_t` (returned range type)
`std::ranges::random_access_range`	`std::ranges::ref_view<urng_t>`
`seqan3::pseudo_random_access_range`	`seqan3::detail::view_enforce_random_access`

The adaptor returns exactly the type specified above. In the second case a view is returned whose iterator wraps the iterator of the underlying range and adapts all of its functionality but overwrites the iterator category to be std::random_access_iterator_tag.

Example

#include <string>
 
#include <seqan3/alignment/decorator/gap_decorator.hpp>
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/utility/views/enforce_random_access.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    // A gap decorator is a pseudo random access range using logarithmic time complexity internally.
    auto seq = "ACGTACGACT"_dna4;
    seqan3::gap_decorator aligned_seq{seq};
 
    // It does not fulfil random access semantics because it does not allow constant time access to aribtrary
    // elements in the range. Thus, it is only a bidirectional range by default.
    static_assert(std::ranges::bidirectional_range<decltype(aligned_seq)>);
    static_assert(!std::ranges::random_access_range<decltype(aligned_seq)>);
 
    // The default interface models at most std::bidirectional_range.
    auto it = std::ranges::begin(aligned_seq);  // Returned iterator models std::bidirectional_iterator.
    std::ranges::advance(it, 3);                // Advancing the iterator takes linear time.
    seqan3::debug_stream << *it << '\n';        // "T"
 
    // After adapting it with enforce_random_access, the returned range models std::random_access_range.
    auto aligned_seq_ra = aligned_seq | seqan3::views::enforce_random_access;
 
    // The pesudo_random_access wrapper returns a view that enforces random_access.
    // Note that this does not mean that the semantic requirements have been changed. Only all syntactical
    // interfaces for the std::ranges::random_access_range are modeled now by the returned view.
    // Access time still depends on the underlying range.
    static_assert(std::ranges::random_access_range<decltype(aligned_seq_ra)>);
 
    auto it_ra = std::ranges::begin(aligned_seq_ra); // Returned iterator models std::random_access_iterator.
    std::ranges::advance(it_ra, 3);                  // Advancing the iterator takes now logarithmic time instead linear.
    seqan3::debug_stream << *it_ra << '\n';          // "T"
}

Complexity

Construction of the returned view is in .

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ get

template<auto index>

constexpr auto seqan3::views::get = views::elements<index>

no-apiinlineconstexpr

A view calling get on each element in a range.

Deprecated:: Please use seqan3::views::elements instead.

◆ interleave

constexpr auto seqan3::views::interleave

experimental-apiinlineconstexpr

A view that interleaves a given range into another range at regular intervals.

Template Parameters

urng_t	The type of the range being processed.
inserted_rng_t	The type of the range being inserted.

Parameters

[in]	urange	The range being processed.
[in]	inserted_range	The range being inserted.
[in]	step_size	A value of size_type which indicates the interval to insert the inserted_range.

Returns: A range with the second range inserted at regular intervals. See below for properties of said range.

Header File

#include <seqan3/utility/views/interleave.hpp>

This view can be used to insert one range into another range at regular intervals. It behaves essentially like | std::views::chunk(step_size) | seqan3::views::join_with(inserted_range) except that for input that models std::ranges::random_access_range and std::ranges::sized_range a more efficient data structure is returned (otherwise it returns exactly the above combination of views).

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range	required	preserved
std::ranges::bidirectional_range	required	preserved
std::ranges::random_access_range	required	preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range	required	preserved
std::ranges::common_range		preserved
std::ranges::output_range		preserved
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t		std::ranges::range_reference_t<urng_t>

If above requirements are not met, this adaptor forwards to | seqan3::views::chunk(step_size) | seqan3::views::join_with(inserted_range) which returns a view with the following properties:

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range	required	lost
std::ranges::bidirectional_range		lost
std::ranges::random_access_range		lost
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		lost
std::ranges::common_range		lost
std::ranges::output_range		lost
seqan3::const_iterable_range		lost

std::ranges::range_reference_t		std::ranges::range_value_t<urng_t>

urng_t is the type of the range modified by this view (input).
rrng_t is the type of the range returned by this view.
for more details, see Views.

Example

#include <string>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/utility/views/interleave.hpp>
 
int main()
{
    std::string u{"FOOBARBAXBAT"};
    std::string i{"in"};
    size_t s = 3;
 
    auto v = u | seqan3::views::interleave(s, i);
 
    seqan3::debug_stream << v << '\n'; // prints FOOinBARinBAXinBAT
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ istreambuf

constexpr auto seqan3::views::istreambuf

no-apiinlineconstexpr

A view factory that returns a view over the stream buffer of an input stream.

Template Parameters

istreambuf_t The type of the stream(buffer); must be std::basic_streambuf or model seqan3::input_stream.

Parameters

[in] istreambuf The stream buffer or an input stream of whom the buffer is retrieved.

Returns

Header File

#include <seqan3/io/detail/istreambuf_view.hpp>

View properties

This is a source-only view adaptor, also known as a range factory; you cannot pipe anything into it.

Concepts and traits	`rrng_t` (returned range type)
std::ranges::input_range	guaranteed
std::ranges::forward_range
std::ranges::bidirectional_range
std::ranges::random_access_range
std::ranges::contiguous_range

std::ranges::viewable_range	guaranteed
std::ranges::view	guaranteed
std::ranges::sized_range
std::ranges::common_range
std::ranges::output_range
seqan3::const_iterable_range	guaranteed

std::ranges::range_reference_t	`istream_t::char_type`

See the views submodule documentation for detailed descriptions of the view properties.

This adaptor is different from std::ranges::basic_istream_view in that it operates directly on the buffer. It further uses a custom streambuf_iterator (not std::istreambuf_iterator) that performs less virtual function calls.

Deprecated:: Use std::ranges::istream_view(std::basic_istream) instead (you need to pass a stream instead of a std::basic_streambuf)

◆ join

constexpr auto seqan3::views::join = ::ranges::views::join

no-apiinlineconstexpr

A join view.

Deprecated:: Please use std::views::join or seqan3::views::join_with (if a separator is needed)

◆ join_with

constexpr auto seqan3::views::join_with = ::ranges::views::join

no-apiinlineconstexpr

A join view, please use std::views::join if you don't need a separator.

This entity is not part of the SeqAn API. Do not rely on it in your applications. This is currently range-v3's join implementation.

◆ kmer_hash

constexpr auto seqan3::views::kmer_hash

stable-apiinlineconstexpr

Computes hash values for each position of a range via a given shape.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in]	urange	The range being processed. [parameter is omitted in pipe notation]
[in]	shape	The seqan3::shape that determines how to compute the hash value.

Returns: A range of std::size_t where each value is the hash of the resp. k-mer. See below for the properties of the returned range.

Attention: For the alphabet size $\sigma$ of the alphabet of urange and the number of 1s of shape it must hold that $s>\frac{64}{\log_2\sigma}$ , i.e. hashes resulting from the shape/alphabet combination can be represented in an uint64_t.

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range	required	preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::semialphabet	std::size_t

See the views submodule documentation for detailed descriptions of the view properties.

Example

#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/search/views/kmer_hash.hpp>
 
using namespace seqan3::literals;
 
int main()
{
    std::vector<seqan3::dna4> text{"ACGTAGC"_dna4};
 
    auto hashes = text | seqan3::views::kmer_hash(seqan3::shape{seqan3::ungapped{3}});
    seqan3::debug_stream << hashes << '\n'; // [6,27,44,50,9]
 
    seqan3::debug_stream << (text | seqan3::views::kmer_hash(seqan3::ungapped{3})) << '\n'; // [6,27,44,50,9]
 
    seqan3::debug_stream << (text | seqan3::views::kmer_hash(0b101_shape)) << '\n'; // [2,7,8,14,1]
}

This entity is stable. Since version 3.1.

◆ minimiser

constexpr auto seqan3::views::minimiser

stable-apiinlineconstexpr

Computes minimisers for a range of comparable values. A minimiser is the smallest value in a window.

Template Parameters

urng_t The type of the first range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in]	urange1	The range being processed. [parameter is omitted in pipe notation]
[in]	window_size	The number of values in one window.

Returns: A range of std::totally_ordered where each value is the minimal value for one window. See below for the properties of the returned range.

A minimiser is the smallest value in a window. For example for the following list of hash values [28, 100, 9, 23, 4, 1, 72, 37, 8] and 4 as window_size, the minimiser values are [9, 4, 1].

The minimiser can be calculated for one given range or for two given ranges, where the minimizer is the smallest value in both windows. For example for the following list of hash values [28, 100, 9, 23, 4, 1, 72, 37, 8] and [30, 2, 11, 101, 199, 73, 34, 900] and 4 as window_size, the minimiser values are [2, 4, 1].

Note that in the interface with the second underlying range the const-iterable property will only be preserved if both underlying ranges are const-iterable.

Robust Winnowing

In case there are multiple minimal values within one window, the minimum and therefore the minimiser is ambiguous. We choose the rightmost value as the minimiser of the window, and when shifting the window, the minimiser is only changed if there appears a value that is strictly smaller than the current minimum. This approach is termed robust winnowing by Chirag et al. and is proven to work especially well on repeat regions.

Example

#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/views/complement.hpp>
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/search/views/kmer_hash.hpp>
#include <seqan3/search/views/minimiser.hpp>
 
using namespace seqan3::literals;
 
int main()
{
    std::vector<seqan3::dna4> text{"ACGTAGC"_dna4};
 
    auto hashes = text | seqan3::views::kmer_hash(seqan3::shape{seqan3::ungapped{3}});
    seqan3::debug_stream << hashes << '\n'; // [6,27,44,50,9]
 
    auto minimiser = hashes | seqan3::views::minimiser(4);
    seqan3::debug_stream << minimiser << '\n'; // [6,9]
 
    // kmer_hash with gaps, hashes: [2,7,8,14,1], minimiser: [2,1]
    seqan3::debug_stream << (text | seqan3::views::kmer_hash(0b101_shape) | seqan3::views::minimiser(4)) << '\n';
 
    /* Minimiser view with two ranges
     * The second range defines the hash values from the reverse complement, the second reverse is necessary to put the
     * hash values in the correct order. For the example here:
     * ACGTAGC | seqan3::views::complement                      => TGCATCG
     *         | std::views::reverse                            => GCTACGT
     *         | seqan3::views::kmer_hash(seqan3::ungapped{3})  => [39 (for GCA), 28 (for CTA), 49 (for TAC),
     *                                                              6 (for ACG), 27 (for CGT)]
     * "GCA" is not the reverse complement from the first k-mer in "ACGTAGC", which is "ACG", but "CGT" is.
     * Therefore, a second reverse is necessary to find the smallest value between the original sequence and its
     * reverse complement.
     */
    auto reverse_complement_hashes  = text | seqan3::views::complement | std::views::reverse
                                           | seqan3::views::kmer_hash(seqan3::ungapped{3}) | std::views::reverse;
    seqan3::debug_stream << reverse_complement_hashes << '\n'; // [27,6,49,28,39]
 
    auto minimiser2 = seqan3::detail::minimiser_view{hashes, reverse_complement_hashes, 4};
    seqan3::debug_stream << minimiser2 << '\n'; // [6,6]
}

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range	required	preserved
std::ranges::bidirectional_range		lost
std::ranges::random_access_range		lost
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		lost
std::ranges::common_range		lost
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	std::totally_ordered	std::totally_ordered

See the views submodule documentation for detailed descriptions of the view properties.

This entity is stable. Since version 3.1.

◆ minimiser_hash

constexpr auto seqan3::views::minimiser_hash

experimental-apiinlineconstexpr

Computes minimisers for a range with a given shape, window size and seed.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in]	urange	The range being processed. [parameter is omitted in pipe notation]
[in]	shape	The seqan3::shape that determines how to compute the hash value.
[in]	window_size	The window size to use.
[in]	seed	The seed used to skew the hash values. Default: 0x8F3F73B5CF1C9ADE.

Returns: A range of size_t where each value is the minimiser of the resp. window. See below for the properties of the returned range.

A sequence can be presented by a small number of k-mers (minimisers). For a given shape and window size all k-mers are determined in the forward strand and the backward strand and only the lexicographically smallest k-mer is returned for one window. This process is repeated over every possible window of a sequence. If consecutive windows share a minimiser, it is saved only once. For example, in the sequence "TAAAGTGCTAAA" for an ungapped shape of length 3 and a window size of 5 the first, the second and the last window contain the same minimiser "AAA". Because the minimisers of the first two consecutive windows also share the same position, storing this minimiser twice is redundant and it is stored only once. The "AAA" minimiser of the last window on the other hand is stored, since it is located at an other position than the previous "AAA" minimiser and hence storing the second "AAA"-minimiser is not redundant but necessary.

Non-lexicographical Minimisers by skewing the hash value with a seed

It might happen that a minimiser changes only slightly when sliding the window over the sequence. For instance, when a minimiser starts with a repetition of A’s, then in the next window it is highly likely that the minimiser will start with a repetition of A’s as well. Because it is only one A shorter, depending on how long the repetition is this might go on for multiple window shifts. Saving these only slightly different minimiser makes no sense because they contain no new information about the underlying sequence. Additionally, sequences with a repetition of A’s will be seen as more similar to each other than they actually are. As Marçais et al. have shown, randomizing the order of the k-mers can solve this problem. Therefore, a random seed is used to XOR all k-mers, thereby randomizing the order. The user can change the seed to any other value he or she thinks is useful. A seed of 0 is returning the lexicographical order.

See also: seqan3::views::minimiser_view

Attention: Be aware of the requirements of the seqan3::views::kmer_hash view.

This entity is experimental and subject to change in the future.

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range	required	preserved
std::ranges::bidirectional_range		lost
std::ranges::random_access_range		lost
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		lost
std::ranges::common_range		lost
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::semialphabet	std::size_t

See the views submodule documentation for detailed descriptions of the view properties.

Example

#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/search/views/minimiser_hash.hpp>
 
using namespace seqan3::literals;
 
int main()
{
    std::vector<seqan3::dna4> text{"CCACGTCGACGGTT"_dna4};
 
    // Here a consecutive shape with size 4 (so the k-mer size is 4) and a window size of 8 is used. The seed is set
    // to 0, so lexicographical ordering is used for demonstration purposes.
    auto minimisers = text | seqan3::views::minimiser_hash(seqan3::shape{seqan3::ungapped{4}},
                                                           seqan3::window_size{8},
                                                           seqan3::seed{0});
    seqan3::debug_stream << minimisers << '\n';
    // This leads to [27,97,26,22,5] representing the k-mers [ACGT, CGAC, ACGG, accg, aacc], smaller case k-mers are
    // coming from the reverse strand.
 
    // Here a gapped shape with size 5 (and a k-mer size of 3) and a window size of 8 is used. The seed is set
    // to 0, so lexicographical ordering is used for demonstration purposes.
    auto minimisers2 = text | seqan3::views::minimiser_hash(0b10101_shape, seqan3::window_size{8}, seqan3::seed{0});
    seqan3::debug_stream << minimisers2 << '\n';
    // This leads to [9, 18, 7, 6] representing the k-mers [A.G.C, C.A.G, a.c.t, a.c.g]
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ move

auto const seqan3::views::move

no-apiinline

A view that turns lvalue-references into rvalue-references.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range whose elements will be moved from.

Header File

#include <seqan3/range/views/move.hpp>

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		preserved

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved
std::semiregular		preserved

std::ranges::range_reference_t		`t &` -> `t &&` but `t` -> `t`

See the views submodule documentation for detailed descriptions of the view properties.

Example

This is a slightly more verbose version of calling std::ranges::move on the range.

#include <seqan3/core/platform.hpp>
 
#ifdef SEQAN3_DEPRECATED_310
#pragma GCC diagnostic push
#pragma GCC diagnostic ignored "-Wdeprecated-declarations"
#include <string>
 
#include <seqan3/range/views/move.hpp>
#include <seqan3/std/algorithm>
#include <seqan3/std/ranges>
 
int main()
{
    std::vector<std::string> vec_in{"ABC", "DEF", "GEH"};
 
    std::vector<std::string> vec_out0{};
    vec_out0.resize(3);
    std::ranges::copy(vec_in,                       // copies strings from in to out
                      vec_out0.begin());
 
    std::vector<std::string> vec_out1{};
    vec_out1.resize(3);
    std::ranges::copy(vec_in | seqan3::views::move, // moves strings from in to out
                      vec_out1.begin());
}
#pragma GCC diagnostic pop
#endif // SEQAN3_DEPRECATED_310

A more useful example can be found in the tutorial .

Deprecated:: Use the std::ranges::move algorithm, std::[cpp20::]move_iterator or an explicit for loop where you move the value.

◆ pairwise_combine

constexpr auto seqan3::views::pairwise_combine

experimental-apiinlineconstexpr

A view adaptor that generates all pairwise combinations of the elements of the underlying range.

Template Parameters

urng_t The type of the range being processed. See below for requirements.

Parameters

[in] urange The range being processed.

Returns: A view over all pairwise combinations of the elements of the underlying range. See below for the properties of the returned range.

Header File

#include <seqan3/utility/views/pairwise_combine.hpp>

This view generates two-element tuples representing all combinations of the elements of the underlying range (the order of the elements is undefined). If the underlying range has less than two elements the returned range is empty, otherwise the size of the returned range corresponds to the binomial coefficient n choose 2, where n is the size of the underlying range. The reference type of this range is a tuple over the reference type of the underlying range. In order to receive the end iterator in constant time an iterator pointing to the last element of the underlying range will be cached upon construction of this view. This construction takes linear time for underlying ranges that do not model std::ranges::bidirectional_range.

Iterator

The returned iterator from begin does not model Cpp17Iterator since it does not return a reference to the represented type but a prvalue. Thus this iterator might not be usable within some legacy algorithms of the STL. But it is guaranteed to work with the ranges algorithms.

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range	required	preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range	required	guaranteed
std::ranges::output_range		preserved
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t		common_tuple<std::ranges::range_reference_t<urng_t>, std::ranges::range_reference_t<urng_t>>

See the views submodule documentation for detailed descriptions of the view properties.

Thread safety

Concurrent access to this view, e.g. while iterating over it, is thread-safe and must not be protected externally.

Example

#include <vector>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/utility/views/pairwise_combine.hpp>
 
int main()
{
    std::vector vec{'a', 'b', 'c', 'a'};
    for (auto res : vec | seqan3::views::pairwise_combine)
    {
        seqan3::debug_stream << res << '\n';
    }
 
    // Possible Output:
    // (a,b)
    // (a,c)
    // (a,a)
    // (b,c)
    // (b,a)
    // (c,a)
}

Attention: This view cannot be chained immediately with an infinite range, because upon construction it will take forever to reach the last element of the view.

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ persist

constexpr auto seqan3::views::persist = detail::persist_fn{}

no-apiinlineconstexpr

A view adaptor that wraps rvalue references of non-views.

Deprecated:: This view is deprecated and will be removed in SeqAn3.1.

◆ rank_to

template<typename alphabet_type >

auto const seqan3::views::rank_to

stable-apiinline

A view over an alphabet, given a range of ranks.

Template Parameters

urng_t	The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]
alphabet_t	The alphabet to convert to; must satisfy seqan3::writable_semialphabet.

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of converted elements. See below for the properties of the returned range.

Header File

#include <seqan3/alphabet/views/rank_to.hpp>

View properties

This view is a deep view Given a range-of-range as input (as opposed to just a range), it will apply the transformation on the innermost range (instead of the outermost range).

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::alphabet_rank_t<alphabet_t>	`alphabet_t`

See the views submodule documentation for detailed descriptions of the view properties.

Example

#include <vector>
 
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/nucleotide/dna5.hpp>
#include <seqan3/alphabet/views/rank_to.hpp>
 
int main()
{
    std::vector<int> vec{0, 1, 3, 3, 3, 2, 0, 3, 0};
    auto v1 = vec | seqan3::views::rank_to<seqan3::dna4>; // == "ACTTTGATA"_dna4
    auto v2 = vec | seqan3::views::rank_to<seqan3::dna5>; // == "ACTTTGATA"_dna5
}

This entity is stable. Since version 3.1.

◆ repeat

constexpr detail::repeat_fn seqan3::views::repeat

no-apiinlineconstexpr

A view factory that repeats a given value infinitely.

Template Parameters

value_t The type of value to repeat wrapped in a std::views::single; must model std::copy_constructible.

Parameters

[in] value The value to repeat.

Returns: An infinite range over value.

Header File

#include <seqan3/utility/views/repeat.hpp>

View properties

This view is source-only, it can only be at the beginning of a pipe of range transformations.

Concepts and traits	`rrng_t` (returned range type)
std::ranges::input_range	guaranteed
std::ranges::forward_range	guaranteed
std::ranges::bidirectional_range	guaranteed
std::ranges::random_access_range	guaranteed
std::ranges::contiguous_range

std::ranges::viewable_range	guaranteed
std::ranges::view	guaranteed
std::ranges::sized_range
std::ranges::common_range
std::ranges::output_range	guaranteed
seqan3::const_iterable_range	guaranteed

std::ranges::range_reference_t	std::remove_reference_t<value_t> &

See the views submodule documentation for detailed descriptions of the view properties.

Attention: The given value to repeat is always copied into the range.

Example

#include <seqan3/std/ranges>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/utility/views/repeat.hpp>
 
int main()
{
    auto v = seqan3::views::repeat('A');
 
    seqan3::debug_stream << *std::ranges::begin(v) << '\n'; // prints 'A'
    seqan3::debug_stream << v[12355] << '\n';               // also prints 'A'. It always prints 'A'
 
    v[1345] = 'C';
 
    // Now it always prints 'C'
    seqan3::debug_stream << *std::ranges::begin(v) << '\n'; // prints 'C'
    seqan3::debug_stream << v[12355] << '\n';               // prints 'C'
}

◆ repeat_n

constexpr auto seqan3::views::repeat_n

no-apiinlineconstexpr

A view factory that repeats a given value n times.

Template Parameters

value_t The type of value to repeat; must be std::copy_constructible.

Parameters

[in]	value	The value to repeat.
[in]	count	The number of times to repeat `value`.

Returns: A range of size count, where each element equals value.

Header File

#include <seqan3/utility/views/repeat_n.hpp>

View properties

This view is source-only, it can only be at the beginning of a pipe of range transformations.

Concepts and traits	`rrng_t` (returned range type)
std::ranges::input_range	guaranteed
std::ranges::forward_range	guaranteed
std::ranges::bidirectional_range	guaranteed
std::ranges::random_access_range	guaranteed
std::ranges::contiguous_range

std::ranges::viewable_range	guaranteed
std::ranges::view	guaranteed
std::ranges::sized_range	guaranteed
std::ranges::common_range
std::ranges::output_range	guaranteed
seqan3::const_iterable_range	guaranteed

std::ranges::range_reference_t	std::remove_reference_t<value_t> &

See the views submodule documentation for detailed descriptions of the view properties.

Attention: The given value to repeat is always copied into the range.

Example

#include <seqan3/std/ranges>
#include <string>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/utility/views/repeat_n.hpp>
 
int main()
{
    auto v = seqan3::views::repeat_n(std::string{"foo"}, 5);
 
    seqan3::debug_stream << v.size() << '\n'; // prints 5
    seqan3::debug_stream << v << '\n';        // prints ["foo", "foo", "foo", "foo", "foo"]
 
    v[0] = std::string{"foobar"};
 
    // Now it always prints "foobar"
    seqan3::debug_stream << *std::ranges::begin(v) << '\n'; // prints "foobar"
    seqan3::debug_stream << v.size() << '\n';               // prints 5; Note: the size cannot be changed anymore
}

◆ single_pass_input

constexpr auto seqan3::views::single_pass_input

no-apiinlineconstexpr

A view adapter that decays most of the range properties and adds single pass behavior.

Template Parameters

urng_t The type of the range being processed. See below for requirements.

Parameters

[in] urange The range being processed.

Returns: A range with single pass input behavior. See below for the properties of the returned range.

Header File

#include <seqan3/utility/views/single_pass_input.hpp>

This view adds single-pass semantics to any input view. This means, that begin always returns the iterator to the current location in the underlying range after k elements have been already consumed and not to the begin of the underlying range, i.e. it mirrors the behavior of an input stream. Note, the view updates an internal state after moving the associated iterator. Thus, the const begin and const end are explicitly deleted.

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		lost
std::ranges::bidirectional_range		lost
std::ranges::random_access_range		lost
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		lost
std::ranges::common_range		lost
std::ranges::output_range		preserved
seqan3::const_iterable_range		lost

std::ranges::range_reference_t		std::ranges::range_reference_t<urng_t>

See the views submodule documentation for detailed descriptions of the view properties.

Thread safety

Concurrent access to this view, e.g. while iterating over it, is not thread-safe and must be protected externally.

Example

#include <string>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/utility/views/single_pass_input.hpp>
 
int main()
{
    std::string str{"hello"};
    auto v = str | seqan3::views::single_pass_input;
    auto b = v.begin();
 
    seqan3::debug_stream << *b << '\n';      // prints 'h'
    seqan3::debug_stream << *(++b) << '\n';  // prints 'e'
    seqan3::debug_stream << *(++b) << '\n';  // prints 'l'
    seqan3::debug_stream << *(++b) << '\n';  // prints 'l'
    seqan3::debug_stream << *(++b) << '\n';  // prints 'o'
}

◆ slice

constexpr auto seqan3::views::slice

no-apiinlineconstexpr

A view adaptor that returns a half-open interval on the underlying range.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in]	urange	The range being processed. [parameter is omitted in pipe notation]
[in]	begin_pos	The beginning of the interval (index of first element returned).
[in]	end_pos	The end of the interval (index behind the last element returned).

Returns: Up to end_pos - begin_pos elements of the underlying range.

Exceptions

std::invalid_argument If end_pos < begin_pos.

Header File

#include <seqan3/utility/views/slice.hpp>

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		preserved

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		preserved
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t		std::ranges::range_reference_t<urng_t>

See the views submodule documentation for detailed descriptions of the view properties.

This adaptor is a combination of std::views::drop and std::views::take.

If begin_pos is larger than the size of the underlying range an empty range is returned. If end_pos is larger than the size of the underlying range less elements are returned.

If end_pos < begin_pos an exception of type std::invalid_argument is thrown.

Return type

`urng_t` (underlying range type)	`rrng_t` (returned range type)
`std::basic_string const &` or `std::basic_string_view`	`std::basic_string_view`
`std::ranges::borrowed_range && std::ranges::sized_range && std::ranges::contiguous_range`	`std::span`
`std::ranges::borrowed_range && std::ranges::sized_range && std::ranges::random_access_range`	`std::ranges::subrange`
else	implementation defined type

The adaptor returns exactly the type specified above.

Complexity

Construction of the returned view is in $O(begin\_pos)$ for some views, see std::views::drop.

Example

#include <seqan3/std/ranges>                // provides std::views::reverse
#include <string>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/utility/views/slice.hpp>   // provides views::slice
 
int main()
{
    std::string s{"foobar"};
    auto v = s | seqan3::views::slice(1,4);
    seqan3::debug_stream << v << '\n';      // "oob"
 
    auto v2 = s | std::views::reverse | seqan3::views::slice(1, 4);
    seqan3::debug_stream << v2 << '\n';     // "abo"
 
}

◆ take

constexpr auto seqan3::views::take

no-apiinlineconstexpr

A view adaptor that returns the first size elements from the underlying range (or less if the underlying range is shorter).

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in]	urange	The range being processed. [parameter is omitted in pipe notation]
[in]	size	The target size of the view.

Returns: Up to size elements of the underlying range.

Header File

#include <seqan3/io/detail/take_view.hpp>

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		preserved

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		preserved
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t		std::ranges::range_reference_t<urng_t>

See the views submodule documentation for detailed descriptions of the view properties.

Return type

`urng_t` (underlying range type)	`rrng_t` (returned range type)
`std::basic_string const &` or `std::basic_string_view`	`std::basic_string_view`
`std::ranges::borrowed_range && std::ranges::sized_range && std::ranges::contiguous_range`	`std::span`
`std::ranges::borrowed_range && std::ranges::sized_range && std::ranges::random_access_range`	`std::ranges::subrange`
else	implementation defined type

This adaptor is different from std::views::take in that it performs type erasure for some underlying ranges. It returns exactly the type specified above.

Some benchmarks have shown that it is also faster than std::views::take for pure forward and input ranges.

Example

#include <seqan3/std/ranges>
#include <string>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/io/detail/take_view.hpp>
 
#ifdef SEQAN3_DEPRECATED_310
#pragma GCC diagnostic push
#pragma GCC diagnostic ignored "-Wdeprecated-declarations"
int main()
{
    std::string vec{"foobar"};
    auto v = vec | seqan3::views::take(3);
    seqan3::debug_stream << v << '\n'; // [f,o,o]
 
    auto v2 = vec | std::views::reverse | seqan3::views::take(3);
    seqan3::debug_stream << v2 << '\n'; // [r,a,b]
}
#pragma GCC diagnostic pop
#endif // SEQAN3_DEPRECATED_310

Deprecated:: Use std::views::take or seqan3::views::type_reduce | std::views::take.

◆ take_line

constexpr auto seqan3::views::take_line = detail::take_line

no-apiinlineconstexpr

A view adaptor that returns a single line from the underlying range.

Deprecated:: Please use std::views::take_while([](auto && chr){ return chr != '\n' })

◆ take_line_or_throw

constexpr auto seqan3::views::take_line_or_throw = detail::take_line_or_throw

no-apiinlineconstexpr

A view adaptor that returns a single line from the underlying range (throws if there is no end-of-line).

Exceptions

seqan3::unexpected_end_of_input If the underlying range contains no end-of-line marker.

Deprecated:: Please use std::views::take_while([](auto && chr){ return chr != '\n' })

◆ take_until_and_consume

constexpr auto seqan3::views::take_until_and_consume = detail::take_until_and_consume

no-apiinlineconstexpr

A view adaptor that returns elements from the underlying range until the functor evaluates to true (or the end of the underlying range is reached and consumes the end in single-pass ranges).

Exceptions

seqan3::unexpected_end_of_input If the underlying range contains no element that satisfies the functor.

Deprecated:: No alternative.

◆ take_until_or_throw_and_consume

constexpr auto seqan3::views::take_until_or_throw_and_consume = detail::take_until_fn<true, true>{}

no-apiinlineconstexpr

A view adaptor that returns elements from the underlying range until the functor evaluates to true (throws if the end of the underlying range is reached and consumes the end in single-pass ranges).

Exceptions

seqan3::unexpected_end_of_input If the underlying range contains no element that satisfies the functor.

Deprecated:: No alternative.

◆ to

constexpr auto seqan3::views::to

no-apiinlineconstexpr

A to view.

This entity is not part of the SeqAn API. Do not rely on it in your applications. This is currently range-v3's to implementation.

◆ to_char

auto const seqan3::views::to_char

stable-apiinline

A view that calls seqan3::to_char() on each element in the input range.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of converted elements. See below for the properties of the returned range.

Header File

#include <seqan3/alphabet/views/to_char.hpp>

View properties

This view is a deep view Given a range-of-range as input (as opposed to just a range), it will apply the transformation on the innermost range (instead of the outermost range).

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::alphabet	seqan3::alphabet_char_t<std::ranges::range_value_t<urng_t>>

See the views submodule documentation for detailed descriptions of the view properties.

Example

#include <vector>
 
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/quality/aliases.hpp> // includes seqan3::dna4q
#include <seqan3/alphabet/quality/phred42.hpp>
#include <seqan3/alphabet/views/to_char.hpp>
#include <seqan3/core/debug_stream.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dna4_vector vec = "ACTTTGATA"_dna4;
    auto v = vec | seqan3::views::to_char;
    seqan3::debug_stream << v << '\n'; // [A,C,T,T,T,G,A,T,A]
 
    std::vector<seqan3::phred42> qvec{seqan3::phred42{}.assign_phred(0),
                                      seqan3::phred42{}.assign_phred(7),
                                      seqan3::phred42{}.assign_phred(5),
                                      seqan3::phred42{}.assign_phred(3),
                                      seqan3::phred42{}.assign_phred(7),
                                      seqan3::phred42{}.assign_phred(4),
                                      seqan3::phred42{}.assign_phred(30),
                                      seqan3::phred42{}.assign_phred(16),
                                      seqan3::phred42{}.assign_phred(23)};
    auto v3 = qvec | seqan3::views::to_char;
    seqan3::debug_stream << v3 << '\n'; // [!,(,&,$,(,%,?,1,8]
 
    std::vector<seqan3::dna4q> qcvec{{'C'_dna4, '!'_phred42}, {'A'_dna4, '('_phred42}, {'G'_dna4, '&'_phred42},
                                     {'T'_dna4, '$'_phred42}, {'G'_dna4, '('_phred42}, {'A'_dna4, '%'_phred42},
                                     {'C'_dna4, '?'_phred42}, {'T'_dna4, '1'_phred42}, {'A'_dna4, '8'_phred42}};
    auto v4 = qcvec | seqan3::views::to_char;
    seqan3::debug_stream << v4 << '\n'; // [C,A,G,T,G,A,C,T,A]
}

This entity is stable. Since version 3.1.

◆ to_lower

auto const seqan3::views::to_lower

no-apiinline

A view that calls seqan3::to_lower() on each element in the input range.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of converted elements. See below for the properties of the returned range.

Header File

#include <seqan3/range/views/to_lower.hpp>

View properties

This view is a deep view Given a range-of-range as input (as opposed to just a range), it will apply the transformation on the innermost range (instead of the outermost range).

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::builtin_character	seqan3::remove_reference_t<std::ranges::range_reference_t<urngt_>>

See the views submodule documentation for detailed descriptions of the view properties.

Example

#ifdef SEQAN3_DEPRECATED_310
#pragma GCC diagnostic push
#pragma GCC diagnostic ignored "-Wdeprecated-declarations"
#include <string>
#include <vector>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/range/views/to_lower.hpp>
 
int main()
{
    std::string s{"CHanGED!"};
    std::vector<std::string> sv{"CHANGED", "unchanged!"};
    auto v1 = s | seqan3::views::to_lower;
    auto v2 = sv | seqan3::views::to_lower;
 
    seqan3::debug_stream << v1 << '\n'; // => "changed!"
    seqan3::debug_stream << v2 << '\n'; // => ["changed", "unchanged!"]
}
#pragma GCC diagnostic pop
#endif // SEQAN3_DEPRECATED_310

Deprecated:: Use std::views::transform([](auto && chr){return std::tolower(chr)});

◆ to_rank

auto const seqan3::views::to_rank

stable-apiinline

A view that calls seqan3::to_rank() on each element in the input range.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of converted elements. See below for the properties of the returned range.

Header File

#include <seqan3/alphabet/views/to_rank.hpp>

View properties

This view is a deep view Given a range-of-range as input (as opposed to just a range), it will apply the transformation on the innermost range (instead of the outermost range).

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::alphabet	seqan3::alphabet_rank_t<std::ranges::range_value_t<urng_t>>

See the views submodule documentation for detailed descriptions of the view properties.

Example

#include <vector>
 
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/quality/phred42.hpp>
#include <seqan3/alphabet/quality/aliases.hpp>
#include <seqan3/alphabet/views/to_rank.hpp>
#include <seqan3/core/debug_stream.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dna4_vector vec = "ACTTTGATA"_dna4;
    auto v = vec | seqan3::views::to_rank;
    seqan3::debug_stream << v << '\n'; // [0,1,3,3,3,2,0,3,0]
 
    std::vector<seqan3::phred42> qvec{seqan3::phred42{}.assign_phred(0),
                                      seqan3::phred42{}.assign_phred(7),
                                      seqan3::phred42{}.assign_phred(5),
                                      seqan3::phred42{}.assign_phred(3),
                                      seqan3::phred42{}.assign_phred(7),
                                      seqan3::phred42{}.assign_phred(4),
                                      seqan3::phred42{}.assign_phred(30),
                                      seqan3::phred42{}.assign_phred(16),
                                      seqan3::phred42{}.assign_phred(23)};
 
    auto v3 = qvec | seqan3::views::to_rank;
    seqan3::debug_stream << v3 << '\n'; // [0,7,5,3,7,4,30,16,23]
 
    std::vector<seqan3::dna4q> qcvec{{'C'_dna4, '!'_phred42}, {'A'_dna4, '('_phred42}, {'G'_dna4, '&'_phred42},
                                     {'T'_dna4, '$'_phred42}, {'G'_dna4, '('_phred42}, {'A'_dna4, '%'_phred42},
                                     {'C'_dna4, '?'_phred42}, {'T'_dna4, '1'_phred42}, {'A'_dna4, '8'_phred42}};
    auto v4 = qcvec | seqan3::views::to_rank;
    seqan3::debug_stream << v4 << '\n'; // [42,7,89,129,91,4,72,142,23]
}

We also convert to unsigned here, because the seqan3::alphabet_rank_t is often uint8_t which is often implemented as unsigned char and thus will not be printed as a number by default.

This entity is stable. Since version 3.1.

◆ to_upper

auto const seqan3::views::to_upper

no-apiinline

A view that calls seqan3::to_upper() on each element in the input range.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: A range of converted elements. See below for the properties of the returned range.

Header File

#include <seqan3/range/views/to_upper.hpp>

View properties

This view is a deep view Given a range-of-range as input (as opposed to just a range), it will apply the transformation on the innermost range (instead of the outermost range).

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		lost
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::builtin_character	seqan3::remove_reference_t<std::ranges::range_reference_t<urngt_>>

See the views submodule documentation for detailed descriptions of the view properties.

Example

#ifdef SEQAN3_DEPRECATED_310
#pragma GCC diagnostic push
#pragma GCC diagnostic ignored "-Wdeprecated-declarations"
#include <string>
#include <vector>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/range/views/to_upper.hpp>
 
int main()
{
    std::string s{"CHanGED!"};
    std::vector<std::string> sv{"changed", "UNCHANGED!"};
    auto v1 = s | seqan3::views::to_upper;
    auto v2 = sv | seqan3::views::to_upper;
 
    seqan3::debug_stream << v1 << '\n'; // => "CHANGED!"
    seqan3::debug_stream << v2 << '\n'; // => ["CHANGED", "UNCHANGED!"]
}
#pragma GCC diagnostic pop
#endif // SEQAN3_DEPRECATED_310

Deprecated:: Use std::views::transform([](auto && chr){return std::toupper(chr)});

◆ translate

constexpr auto seqan3::views::translate

experimental-apiinlineconstexpr

A view that translates nucleotide into aminoacid alphabet with 1, 2, 3 or 6 frames.

Template Parameters

urng_t The type of the range being processed.

Parameters

[in]	urange	The range being processed.
[in]	tf	A value of seqan3::tanslation_frames that indicates the desired frames.

Returns: A range of ranges containing frames with aminoacid sequence. See below for the properties of the returned range.

Header File

#include <seqan3/alphabet/views/translate.hpp>

This view can be used to translate nucleotide sequences into aminoacid sequences (see translation_frames for possible combination of frames).

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range	required	preserved
std::ranges::bidirectional_range	required	preserved
std::ranges::random_access_range	required	preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range	required	preserved
std::ranges::common_range		guaranteed
std::ranges::output_range		lost
seqan3::const_iterable_range	required	preserved

std::ranges::range_reference_t	seqan3::nucleotide_alphabet	std::ranges::view && std::ranges::random_access_range && std::ranges::sized_range

urng_t is the type of the range modified by this view (input).
rrng_type is the type of the range returned by this view.
for more details, see Views.

Example

Operating on a range of seqan3::dna5:

#include <seqan3/alphabet/nucleotide/dna5.hpp>
#include <seqan3/alphabet/views/complement.hpp>
#include <seqan3/alphabet/views/translate.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dna5_vector vec{"ACGTACGTACGTA"_dna5};
 
    // default frame translation
    auto v1 = vec | seqan3::views::translate;
    // == [[T,Y,V,R],[R,T,Y,V],[V,R,T],[Y,V,R,T],[T,Y,V,R],[R,T,Y]]
 
    // single frame translation
    auto v2 = vec | seqan3::views::translate(seqan3::translation_frames::forward_frame0);
    // == [[T,Y,V,R]]
 
    // reverse translation
    auto v3 = vec | seqan3::views::translate(seqan3::translation_frames::forward_reverse0);
    // == [[T,Y,V,R],[Y,V,R,T]]
 
    // forward frames translation
    auto v4 = vec | seqan3::views::translate(seqan3::translation_frames::forward_frames);
    // == [[T,Y,V,R],[R,T,Y,V],[V,R,T]]
 
    // six frame translation
    auto v5 = vec | seqan3::views::translate(seqan3::translation_frames::six_frames);
    // == [[T,Y,V,R],[R,T,Y,V],[V,R,T],[Y,V,R,T],[T,Y,V,R],[R,T,Y]]
 
    // function syntax
    auto v6 = seqan3::views::translate(vec, seqan3::translation_frames::forward_reverse0);
    // == [[T,Y,V,R],[Y,V,R,T]]
 
    // combinability
    auto v7 = vec | seqan3::views::complement | seqan3::views::translate(seqan3::translation_frames::forward_reverse0);
    // == [[C,M,H,A],[M,H,A,C]]
}

See also: seqan3::translate_triplet; seqan3::views::translate_single; seqan3::views::translate_join

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ translate_join

constexpr auto seqan3::views::translate_join

experimental-apiinlineconstexpr

A view that translates nucleotide into aminoacid alphabet with 1, 2, 3 or 6 frames. Input and output range are always two-dimensional.

Template Parameters

urng_t The type of the range being processed.

Parameters

[in]	urange	The range being processed. Needs to be a range of ranges (two-dimensional).
[in]	tf	A value of seqan3::tanslation_frames that indicates the desired frames.

Returns: A range of ranges containing frames with aminoacid sequence. See below for the properties of the returned range.

Header File

#include <seqan3/alphabet/views/translate_join.hpp>

This view can be used to translate nucleotide sequences into aminoacid sequences (see translation_frames for possible combination of frames). This view only operates on two-dimensional input (range of ranges) and outputs a range of ranges no matter the number of input sequences or the number of translation frames given. Therefore, it has the same capabilities as the standard view_translate but concatenates the different frames of the different input sequences rather than having a separate range for each input sequence containing the translated frames. In the output, frames are ordered in a way, that all requested frames are listed per sequence directly after each other in the order of input sequences. improved and efficient downstream post-processing if needed. However, the index of a frame for a specific sequence needs to be calculated via modulo operations in this case. The i-th frame of the j-th sequence can be calculated by n = (i * s) + j, where s is the number of frames used for translation (index starting at zero).

In short, this views behaves the same as:

std::vector<std::vector<dna5>> vec {...};

auto v = vec | views::translate | std::views::join;

seqan3::views::join

constexpr auto join

A join view.

Definition: join_with.hpp:29

Except that the performance is better and the returned range still models std::ranges::random_access_range and std::ranges::sized_range.

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range	required	preserved
std::ranges::bidirectional_range	required	preserved
std::ranges::random_access_range	required	preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range	required	preserved
std::ranges::common_range		guaranteed
std::ranges::output_range		lost
seqan3::const_iterable_range	required	preserved

std::ranges::range_reference_t	seqan3::nucleotide_alphabet	std::ranges::view && std::ranges::random_access_range && std::ranges::sized_range

urng_t is the type of the range modified by this view (input).
rrng_t is the type of the range returned by this view.
for more details, see Views.

Example

Operating on a range of seqan3::dna5:

#include <iostream>
 
#include <seqan3/alphabet/nucleotide/dna4.hpp>
#include <seqan3/alphabet/views/char_to.hpp>
#include <seqan3/alphabet/views/translate_join.hpp>
#include <seqan3/core/debug_stream.hpp>
 
using namespace seqan3::literals;
 
int main()
{
    // Input range needs to be two-dimensional
    std::vector<std::vector<seqan3::dna4> > vec{"ACGTACGTACGTA"_dna4, "TCGAGAGCTTTAGC"_dna4};
 
    // Translation with default parameters
    auto v1 = vec | seqan3::views::translate_join;
    seqan3::debug_stream << v1 << "\n"; // [TYVR,RTYV,VRT,YVRT,TYVR,RTY,SRAL,REL*,ESFS,AKAL,LKLS,*SSR]
 
    // Access the third forward frame (index_frame 2) of the second input sequence (index_seq 1)
    // Required frames per sequence s = 6
    // n = (index_seq * s) + j
    //   = 1 * 6 + 2
    //   = 8
 
    auto third_frame_second_seq = v1[1 * 6 + 2];
    seqan3::debug_stream << third_frame_second_seq << "\n"; // ESFS
 
    // Translation with custom translation frame
    auto v2 = vec | seqan3::views::translate_join(seqan3::translation_frames::forward_frame0);
    seqan3::debug_stream << v2 << "\n"; // [TYVR,SRAL]
 
    return 0;
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ translate_single

constexpr auto seqan3::views::translate_single

experimental-apiinlineconstexpr

A view that translates nucleotide into aminoacid alphabet for one of the six frames.

Template Parameters

urng_t The type of the range being processed.

Parameters

[in]	urange	The range being processed.
[in]	tf	A value of seqan3::translation_frames that indicates the desired frames.

Returns: A range containing frames with aminoacid sequence. See below for the properties of the returned range.

Header File

#include <seqan3/alphabet/views/translate.hpp>

This view can be used to translate nucleotide sequences into aminoacid sequences (see translation_frames for possible combination of frames).

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range	required	preserved
std::ranges::bidirectional_range	required	preserved
std::ranges::random_access_range	required	preserved
std::ranges::contiguous_range		lost

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range	required	preserved
std::ranges::common_range		guaranteed
std::ranges::output_range		lost
seqan3::const_iterable_range	required	preserved

std::ranges::range_reference_t	seqan3::nucleotide_alphabet	seqan3::aa27

urng_t is the type of the range modified by this view (input).
rrng_type is the type of the range returned by this view.
for more details, see Views.

Example

Operating on a range of seqan3::dna5:

#include <seqan3/alphabet/nucleotide/dna5.hpp>
#include <seqan3/alphabet/views/complement.hpp>
#include <seqan3/alphabet/views/translate.hpp>
#include <seqan3/core/debug_stream.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    seqan3::dna5_vector vec{"ACGTACGTACGTA"_dna5};
 
    // Default (first forward frame)
    auto v1 = vec | seqan3::views::translate_single;
    // == [T,Y,V,R]
    seqan3::debug_stream << v1[1] << '\n';
 
    // First forward frame
    auto v2 = vec | seqan3::views::translate_single(seqan3::translation_frames::forward_frame0);
    // == [T,Y,V,R]
 
    // First reverse frame
    auto v3 = vec | seqan3::views::translate_single(seqan3::translation_frames::reverse_frame0);
    // == [Y,V,R,T]
 
    // Second forward frame
    auto v4 = vec | seqan3::views::translate_single(seqan3::translation_frames::forward_frame1);
    // == [R,T,Y,V]
 
    // Second reverse frame
    auto v5 = vec | seqan3::views::translate_single(seqan3::translation_frames::reverse_frame1);
    // == [T,Y,V,R]
 
    // Third forward frame
    auto v6 = vec | seqan3::views::translate_single(seqan3::translation_frames::forward_frame2);
    // == [V,R,T]
 
    // Third reverse frame
    auto v7 = vec | seqan3::views::translate_single(seqan3::translation_frames::reverse_frame2);
    // == [R,T,Y]
 
    // function syntax
    auto v8 = seqan3::views::translate_single(vec, seqan3::translation_frames::forward_frame0);
    // == [T,Y,V,R]
 
    // combinability
    auto v9 = vec
            | seqan3::views::complement
            | seqan3::views::translate_single(seqan3::translation_frames::reverse_frame0);
    // == [M,H,A,C]
 
    // combinability with default parameter
    auto v10 = vec | seqan3::views::complement | seqan3::views::translate_single;
    // == [C,M,H,A]
 
    // combinability with default parameter
    auto v11 = vec | seqan3::views::complement | seqan3::views::translate_single();
    // == [C,M,H,A]
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ trim_quality

constexpr auto seqan3::views::trim_quality

experimental-apiinlineconstexpr

A view that does quality-threshold trimming on a range of seqan3::quality_alphabet.

Template Parameters

urng_t	The type of the range being processed. See below for requirements.
threshold_t	Either std::ranges::range_value_t<urng_t> or seqan3::alphabet_phred_t<std::ranges::range_value_t<urng_t>>.

Parameters

[in]	urange	The range being processed. [parameter is omitted in pipe notation]
[in]	threshold	The minimum quality.

Returns: A trimmed range. See below for the properties of the returned range.

Header File

#include <seqan3/alphabet/views/trim_quality.hpp>

This view can be used to trim sequences based on quality. Only bases at the end of the sequence not meeting the specified threshold are discarded.

View properties

This view is a deep view Given a range-of-range as input (as opposed to just a range), it will apply the transformation on the innermost range (instead of the outermost range).

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved

std::ranges::view		guaranteed
std::ranges::sized_range		lost
std::ranges::common_range		lost
std::ranges::output_range		preserved
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t	seqan3::quality_alphabet	std::ranges::range_reference_t<urng_t>

See the views submodule documentation for detailed descriptions of the view properties.

Example

Operating on a range of seqan3::phred42:

#include <string>
#include <vector>
 
#include <seqan3/alphabet/quality/phred42.hpp>
#include <seqan3/alphabet/views/to_char.hpp>
#include <seqan3/alphabet/views/trim_quality.hpp>
 
using namespace seqan3::literals;
 
int main()
{
    std::vector<seqan3::phred42> vec{"II?5+"_phred42};
 
    // trim by phred_value
    auto v1 = vec | seqan3::views::trim_quality(20u);                            // == ['I','I','?','5']
 
    // trim by quality character
    auto v2 = vec | seqan3::views::trim_quality('I'_phred42);                    // == ['I','I']
 
    // function syntax
    auto v3 = seqan3::views::trim_quality(vec, '5'_phred42);                     // == ['I','I','?','5']
 
    // combinability
    auto v4 = seqan3::views::trim_quality(vec, 20u) | seqan3::views::to_char;    // == "II?5"
}

Or operating on a range of seqan3::dna5q:

#include <string>
#include <vector>
 
#include <seqan3/alphabet/nucleotide/dna5.hpp>
#include <seqan3/alphabet/quality/aliases.hpp>
#include <seqan3/alphabet/quality/phred42.hpp>
#include <seqan3/alphabet/views/to_char.hpp>
#include <seqan3/alphabet/views/trim_quality.hpp>
 
int main()
{
    using namespace seqan3::literals;
 
    std::vector<seqan3::dna5q> vec{{'A'_dna5, 'I'_phred42},
                                   {'G'_dna5, 'I'_phred42},
                                   {'G'_dna5, '?'_phred42},
                                   {'A'_dna5, '5'_phred42},
                                   {'T'_dna5, '+'_phred42}};
    std::vector<seqan3::dna5q> cmp{{'A'_dna5, 'I'_phred42},
                                   {'G'_dna5, 'I'_phred42},
                                   {'G'_dna5, '?'_phred42},
                                   {'A'_dna5, '5'_phred42}};
 
    // trim by phred_value
    auto v1 = vec | seqan3::views::trim_quality(20u);
    assert(std::ranges::equal(v1, cmp));
 
    // trim by quality character; in this case the nucleotide part of the character is irrelevant
    auto v2 = vec | seqan3::views::trim_quality(seqan3::dna5q{'C'_dna5, '5'_phred42});
    assert(std::ranges::equal(v2, cmp));
 
    // combinability
    auto v3 = seqan3::views::trim_quality(vec, 20u) | seqan3::views::to_char;
    assert(std::ranges::equal(std::string{"AGGA"}, v3));
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ type_reduce

constexpr auto seqan3::views::type_reduce

experimental-apiinlineconstexpr

A view adaptor that behaves like std::views::all, but type erases certain ranges.

Template Parameters

urng_t The type of the range being processed. See below for requirements. [template parameter is omitted in pipe notation]

Parameters

[in] urange The range being processed. [parameter is omitted in pipe notation]

Returns: The range turned into a view.

Header File

#include <seqan3/utility/views/view_type_reduce.hpp>

View properties

Concepts and traits	`urng_t` (underlying range type)	`rrng_t` (returned range type)
std::ranges::input_range	required	preserved
std::ranges::forward_range		preserved
std::ranges::bidirectional_range		preserved
std::ranges::random_access_range		preserved
std::ranges::contiguous_range		preserved

std::ranges::viewable_range	required	guaranteed
std::ranges::view		guaranteed
std::ranges::sized_range		preserved
std::ranges::common_range		preserved
std::ranges::output_range		preserved
seqan3::const_iterable_range		preserved

std::ranges::range_reference_t		std::ranges::range_reference_t<urng_t>

See the views submodule documentation for detailed descriptions of the view properties.

Return type

`urng_t` (underlying range type)	`rrng_t` (returned range type)
`std::ranges::view`	`urng_t`
`std::basic_string const &` or `std::basic_string_view`	`std::basic_string_view`
`std::ranges::borrowed_range && std::ranges::sized_range && std::ranges::contiguous_range`	`std::span`
`std::ranges::borrowed_range && std::ranges::sized_range && std::ranges::random_access_range`	`std::ranges::subrange`
else	`std::ranges::ref_view<urng_t>`

This adaptor is different from std::views::all in that it performs type erasure for some underlying ranges; std::views::all always returns std::ranges::ref_view<urng_t> or the type itself if it already is a view.

Example

#include <string>
#include <vector>
 
#include <seqan3/core/debug_stream.hpp>
#include <seqan3/utility/views/type_reduce.hpp>
 
int main()
{
    std::string const vec{"foobar"};
    auto v = vec | seqan3::views::type_reduce;          // pipe notation; v is of type std::string_view
    seqan3::debug_stream << v << '\n';                  // "foobar"
 
    std::vector vec2{1, 2, 3};
    auto v2 = seqan3::views::type_reduce(vec2);         // functional notation; v2 is of type std::span
    seqan3::debug_stream << v2 << '\n';                 // "[1, 2, 3]"
}

This entity is experimental and subject to change in the future. Experimental since version 3.1.

◆ zip

constexpr auto seqan3::views::zip = ::ranges::views::zip

no-apiinlineconstexpr

A zip view.

This entity is not part of the SeqAn API. Do not rely on it in your applications. This is currently range-v3's zip implementation.

Files

Classes

Variables

Alphabet related views

General purpose views

Detailed Descriptionno-api

Namespaces

Example

Views vs view adaptors

View properties

Variable Documentation

◆ as_const

View properties

Example

◆ async_input_buffer

Summary

Size of the buffer

Range consumption

View properties

Thread safety

Example

◆ char_to

View properties

Example

◆ chunk

◆ complement

View properties

Example

◆ convert

View properties

Example

◆ drop

View properties

Return type

Complexity

Example

◆ elements

View properties

Example

◆ enforce_random_access

View properties

Return type

Example

Complexity

◆ get

◆ interleave

View properties

Example

◆ istreambuf

View properties

◆ join

◆ join_with

◆ kmer_hash

View properties

Example

◆ minimiser

Robust Winnowing

Example

View properties

◆ minimiser_hash

Non-lexicographical Minimisers by skewing the hash value with a seed

View properties

Example

◆ move

View properties

Example

◆ pairwise_combine

Iterator

View properties

Thread safety

Example

◆ persist

◆ rank_to

View properties

Example

◆ repeat

View properties

Example

◆ repeat_n

View properties