SeqAn3 3.4.0-rc.1
The Modern C++ library for sequence analysis.
No Matches
seqan3::structure_file_input< traits_type_, selected_field_ids_, valid_formats_ > Class Template Reference

A class for reading structured sequence files, e.g. Stockholm, Connect, Vienna, ViennaRNA bpp matrix ... More...

#include <seqan3/io/structure_file/input.hpp>

Public Types

using field_ids = fields< field::seq, field::id, field::bpp, field::structure, field::structured_seq, field::energy, field::react, field::react_err, field::comment, field::offset >
 The subset of seqan3::field IDs that are valid for this file; order corresponds to the types in field_types.
Template arguments

Exposed as member types for public access.

using traits_type = traits_type_
 A traits type that defines aliases and template for storage of the fields.
using selected_field_ids = selected_field_ids_
 A seqan3::fields list with the fields selected for the record.
using valid_formats = valid_formats_
 A seqan3::type_list with the possible formats.
using stream_char_type = char
 Character type of the stream(s).
Field types and record type

These types are relevant for record/row-based reading; they may be manipulated via the traits_type to achieve different storage behaviour.

using seq_type = typename traits_type::template seq_container< typename traits_type::seq_alphabet >
 The type of the sequence field (default std::vector of seqan3::rna5).
using id_type = typename traits_type::template id_container< typename traits_type::id_alphabet >
 The type of the ID field (default std::string).
using bpp_type = typename traits_type::template bpp_container< typename traits_type::template bpp_queue< typename traits_type::template bpp_item< typename traits_type::bpp_prob, typename traits_type::bpp_partner > > >
 The type of the base pair probabilies (default std::vector of std::set<std::pair<double, size_t>>).
using structure_type = typename traits_type::template structure_container< typename traits_type::structure_alphabet >
 The type of the structure field (default std::vector of seqan3::wuss51).
using structured_seq_type = typename traits_type::template structured_seq_container< typename traits_type::template structured_seq_alphabet< typename traits_type::seq_alphabet, typename traits_type::structure_alphabet > >
 The type of the sequence-structure field (default std::vector of structured_rna<rna5, wuss51>).
using energy_type = typename traits_type::energy_type
 The type of the energy field (default double).
using react_type = typename traits_type::template react_container< typename traits_type::react_type >
 The type of the reactivity and reactivity error fields (default double).
using comment_type = typename traits_type::template comment_container< typename traits_type::comment_alphabet >
 The type of the comment field (default double).
using offset_type = typename traits_type::offset_type
 The type of the offset field (default size_t).
using field_types = type_list< seq_type, id_type, bpp_type, structure_type, structured_seq_type, energy_type, react_type, react_type, comment_type, offset_type >
 The previously defined types aggregated in a seqan3::type_list.
using record_type = structure_record< detail::select_types_with_ids_t< field_types, field_ids, selected_field_ids >, selected_field_ids >
 The type of the record, a specialisation of seqan3::record; acts as a tuple of the selected field types.
Range associated types

The types necessary to facilitate the behaviour of an input range (used in record-wise reading).

using value_type = record_type
 The value_type is the record_type.
using reference = record_type &
 The reference type.
using const_reference = void
 The const_reference type is void, because files are not const-iterable.
using size_type = size_t
 An unsigned integer type, usually std::size_t.
using difference_type = std::make_signed_t< size_t >
 A signed integer type, usually std::ptrdiff_t.
using iterator = detail::in_file_iterator< structure_file_input >
 The iterator type of this view (an input iterator).
using const_iterator = void
 The const iterator type is void, because files are not const-iterable.
using sentinel = std::default_sentinel_t
 The type returned by end().

Public Member Functions

Constructors, destructor and assignment
 structure_file_input ()=delete
 Default constructor is explicitly deleted, you need to give a stream or file name.
 structure_file_input (structure_file_input const &)=delete
 Copy construction is explicitly deleted, because you cannot have multiple access to the same file.
structure_file_inputoperator= (structure_file_input const &)=delete
 Copy assignment is explicitly deleted, because you cannot have multiple access to the same file.
 structure_file_input (structure_file_input &&)=default
 Move construction is defaulted.
structure_file_inputoperator= (structure_file_input &&)=default
 Move assignment is defaulted.
 ~structure_file_input ()=default
 Destructor is defaulted.
 structure_file_input (std::filesystem::path filename, selected_field_ids const &fields_tag=selected_field_ids{})
 Construct from filename.
template<input_stream stream_t, structure_file_input_format file_format>
requires std::same_as<typename std::remove_reference_t<stream_t>::char_type, char>
 structure_file_input (stream_t &stream, file_format const &format_tag, selected_field_ids const &fields_tag=selected_field_ids{})
 Construct from an existing stream and with specified format.
template<input_stream stream_t, structure_file_input_format file_format>
requires std::same_as<typename std::remove_reference_t<stream_t>::char_type, char>
 structure_file_input (stream_t &&stream, file_format const &format_tag, selected_field_ids const &fields_tag=selected_field_ids{})
 This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.
Range interface

Provides functions for record based reading of the file.

iterator begin ()
 Returns an iterator to current position in the file.
sentinel end () noexcept
 Returns a sentinel for comparison with iterator.
reference front () noexcept
 Return the record we are currently at in the file.

Public Attributes

structure_file_input_options< typename traits_type::seq_legal_alphabet, selected_field_ids::contains(field::structured_seq)> options
 The options are public and its members can be set directly.

Related Symbols

(Note that these are not member symbols.)

Type deduction guides
template<input_stream stream_type, structure_file_input_format file_format, detail::fields_specialisation selected_field_ids>
 structure_file_input (stream_type &&stream, file_format const &, selected_field_ids const &) -> structure_file_input< typename structure_file_input<>::traits_type, selected_field_ids, type_list< file_format > >
 Deduction of the selected fields, the file format and the stream type.
template<input_stream stream_type, structure_file_input_format file_format, detail::fields_specialisation selected_field_ids>
 structure_file_input (stream_type &stream, file_format const &, selected_field_ids const &) -> structure_file_input< typename structure_file_input<>::traits_type, selected_field_ids, type_list< file_format > >
 This is an overloaded member function, provided for convenience. It differs from the above function only in what argument(s) it accepts.

Detailed Description

template<structure_file_input_traits traits_type_ = structure_file_input_default_traits_rna, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::structure>, detail::type_list_of_structure_file_input_formats valid_formats_ = type_list<format_vienna>>
class seqan3::structure_file_input< traits_type_, selected_field_ids_, valid_formats_ >

A class for reading structured sequence files, e.g. Stockholm, Connect, Vienna, ViennaRNA bpp matrix ...

Template Parameters
traits_typeAn auxiliary type that defines certain member types and constants, must satisfy seqan3::structure_file_input_traits.
selected_field_idsA seqan3::fields type with the list and order of desired record entries; all fields must be in seqan3::structure_file_input::field_ids.
valid_formatsA seqan3::type_list of the selectable formats (each must meet seqan3::structure_file_input_format).

Reading structure files

Structured sequence files contain intra-molecular interactions of RNA or protein. Usually, but not necessarily, they contain the nucleotide or amino acid sequences and descriptions as well. Interactions can be represented either as fixed secondary structure, where every character is assigned at most one interaction partner (structure of minimum free energy), or an annotated sequence, where every character is assigned a set of interaction partners with specific base pair probabilities.

The structured sequence file abstraction supports reading ten different fields:
  1. seqan3::field::seq (sequence)
  2. seqan3::field::id (identifier)
  3. seqan3::field::bpp (annotated sequence)
  4. seqan3::field::structure (secondary structure)
  5. seqan3::field::structured_seq (sequence and structure in one range)
  6. seqan3::field::energy (minimum free energy)
  7. seqan3::field::react (reactivity)
  8. seqan3::field::react_err (reactivity error)
  9. seqan3::field::comment (free text)
  10. seqan3::field::offset (index of first sequence character)
The first three fields are retrieved by default (and in that order). The seqan3::field::structured_seq may be selected to have sequence and structure directly stored in a more memory-efficient combined container. If you select this field you must not select seqan3::field::seq or seqan3::field::structure.

Construction and specialisation

This class comes with two constructors, one for construction from a file name and one for construction from an existing stream and a known format. The first one automatically picks the format based on the extension of the file name. The second can be used if you have a non-file stream, like std::cin or std::istringstream, that you want to read from and/or if you cannot use file-extension based detection, but know that your input file has a certain format.

In most cases the template parameters are deduced completely automatically, e.g. reading from a std::istringstream:
// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <filesystem>
#include <sstream>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
..(((((..(((...)))..)))))... (-3.71))";
int main()
auto tmp_file = std::filesystem::temp_directory_path() / "my.dbn";
using namespace seqan3::literals;
// First, make /tmp/input.dbn
"S.cerevisiae_tRNA-PHE M10740/1-73",
fout.emplace_back("UUGGAGUACACAACCUGUACACUCUUUC"_rna4, "example", "..(((((..(((...)))..)))))..."_wuss51);
seqan3::structure_file_input sf{tmp_file}; // Vienna with RNA sequences assumed, use regular std::ifstream as stream
// ^ no need to specify the template arguments
The Vienna format (dot bracket notation) for RNA sequences with secondary structure.
Definition format_vienna.hpp:83
A class for reading structured sequence files, e.g. Stockholm, Connect, Vienna, ViennaRNA bpp matrix ...
Definition structure_file/input.hpp:358
A class for writing structured sequence files, e.g. Stockholm, Connect, Vienna, ViennaRNA bpp matrix ...
Definition io/structure_file/output.hpp:60
void emplace_back(arg_t &&arg, arg_types &&... args)
Write a record to the file by passing individual fields.
Definition io/structure_file/output.hpp:363
Provides seqan3::structure_file_output and corresponding traits classes.
The SeqAn namespace for literals.
T remove(T... args)
Provides seqan3::rna4, container aliases and string literals.
Provides seqan3::structure_file_input and corresponding traits classes.
T temp_directory_path(T... args)
Provides the WUSS format for RNA structure.
Note that this is not the same as writing structure_file_input<> (with angle brackets). In the latter case they are explicitly set to their default values, in the former case automatic deduction happens which chooses different parameters depending on the constructor arguments. For opening from file, structure_file_input<> would have also worked, but for opening from stream it would not have.

In some cases, you do need to specify the arguments, e.g. if you want to read amino acids:
// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <sstream>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
..(((((..(((...)))..)))))... (-3.71))";
int main()
You can define your own traits type to further customise the types used by and returned by this class, see seqan3::structure_file_default_traits_rna for more details. As mentioned above, specifying at least one template parameter yourself means that you loose automatic deduction so if you want to read amino acids and want to read from a string stream you need to give all types yourself:
// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <sstream>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
> example
int main()
// ... input had amino acid sequences
A class template that holds a choice of seqan3::field.
Definition record.hpp:125
A traits type that specifies input as amino acids.
Definition structure_file/input.hpp:318
Type that contains multiple types.
Definition type_list.hpp:26
Provides seqan3::type_list.

Reading record-wise

You can iterate over this file record-wise:
// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <sstream>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
> example
int main()
using structure_file_input_t =
structure_file_input_t fin{std::istringstream{input}, seqan3::format_vienna{}};
for (auto & rec : fin)
seqan3::debug_stream << "ID: " << << '\n';
// sequence and structure are converted to char on-the-fly
seqan3::debug_stream << "SEQ: " << (rec.sequence() | seqan3::views::to_char) << '\n';
seqan3::debug_stream << "STRUCTURE: " << (rec.sequence_structure() | seqan3::views::to_char) << '\n';
Provides seqan3::debug_stream and related types.
auto const to_char
A view that calls seqan3::to_char() on each element in the input range.
Definition to_char.hpp:60
debug_stream_type debug_stream
A global instance of seqan3::debug_stream_type.
Definition debug_stream.hpp:37
Provides seqan3::views::to_char.
In the above example, rec has the type seqan3::structure_file_input::record_type which is a specialisation of seqan3::record and behaves like a std::tuple (that's why we can access it via get). Instead of using the seqan3::field based interface on the record, you could also use std::get<0> or even std::get<rna4_vector> to retrieve the sequence, but it is not recommended, because it is more error-prone.

Note: It is important to write auto & and not just auto, otherwise you will copy the record on every iteration. Since the buffer gets "refilled" on every iteration, you can also move the data out of the record if you want to store it somewhere without copying:
// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <sstream>
#include <utility>
#include <vector>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
..(((((..(((...)))..)))))... (-3.71))";
int main()
using record_type = typename decltype(fin)::record_type;
for (auto & rec : fin)
structure_record< detail::select_types_with_ids_t< field_types, field_ids, selected_field_ids >, selected_field_ids > record_type
The type of the record, a specialisation of seqan3::record; acts as a tuple of the selected field typ...
Definition structure_file/input.hpp:449
T move(T... args)
SeqAn specific customisations in the standard namespace.

Reading record-wise (decomposed records)

Instead of using get on the record, you can also use structured bindings to decompose the record into its elements:
// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <sstream>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
> example
int main()
using seqan3::get;
using structure_file_input_t =
structure_file_input_t fin{std::istringstream{input}, seqan3::format_vienna{}};
for (auto & [seq, id, structure] : fin)
seqan3::debug_stream << "ID: " << id << '\n';
// sequence and structure are converted to char on-the-fly
seqan3::debug_stream << "SEQ: " << (seq | seqan3::views::to_char) << '\n';
seqan3::debug_stream << "STRUCTURE: " << (structure | seqan3::views::to_char) << '\n';
@ structure
Fixed interactions, usually a string of structure alphabet characters.
@ seq
The "sequence", usually a range of nucleotides or amino acids.
constexpr auto const & get(configuration< configs_t... > const &config) noexcept
This is an overloaded member function, provided for convenience. It differs from the above function o...
Definition configuration.hpp:412
In this case you immediately get the three elements of the tuple: seq of seqan3::structure_file_input::seq_type, id of seqan3::structure_file_input::id_type and structure of seqan3::structure_file_input::structure_type. But beware: with structured bindings you do need to get the order of elements correctly!

Reading record-wise (custom fields)

If you want to skip specific fields from the record you can pass a non-empty fields trait object to the structure_file_input constructor to select the fields that should be read from the input. For example to choose a combined field for SEQ and STRUCTURE (see above). Or to never actually read the STRUCTURE, if you don't need it. The following snippets demonstrate the usage of such a fields trait object.
// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <sstream>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
..(((((..(((...)))..)))))... (-3.71))";
int main()
using seqan3::get;
// note that the order is now different, "id" comes first, because it was specified first
for (auto & [id, struc_seq] : fin)
seqan3::debug_stream << "ID: " << id << '\n';
// sequence and structure are part of the same vector, of type std::vector<structured_rna<rna5, wuss51>>
// sequence and structure strings are extracted and converted to char on-the-fly
seqan3::debug_stream << "SEQ: " << (struc_seq | seqan3::views::elements<0> | seqan3::views::to_char) << '\n';
seqan3::debug_stream << "STRUCTURE: " << (struc_seq | seqan3::views::elements<1> | seqan3::views::to_char)
<< '\n';
Provides seqan3::views::elements.
When reading a file, all fields not present in the file (but requested implicitly or via the selected_field_ids parameter) are ignored.

Views on files

Since SeqAn files are ranges, you can also create views over files. A useful example is to filter the records based on certain criteria, e.g. minimum length of the sequence field:
// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <ranges>
#include <sstream>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
..(((((..(((...)))..)))))... (-3.71))";
int main()
auto minimum_length5_filter = std::views::filter(
[](auto const & rec)
return std::ranges::size(rec.sequence()) >= 5;
for (auto & rec : fin | minimum_length5_filter) // only record with sequence length >= 5 will "appear"
seqan3::debug_stream << (rec.sequence() | seqan3::views::to_char) << '\n';
constexpr auto to_char
Return the char representation of an alphabet object.
Definition alphabet/concept.hpp:381
The generic concept for a (biological) sequence.
The main SeqAn3 namespace.
Definition aligned_sequence_concept.hpp:26

End of file

You can check whether a file is at end by comparing begin() and end() (if they are the same, the file is at end).


Currently, the only implemented format is seqan3::format_vienna. More formats will follow soon.

For a complete overview, take a look at Structure File

Constructor & Destructor Documentation

◆ structure_file_input() [1/2]

template<structure_file_input_traits traits_type_ = structure_file_input_default_traits_rna, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::structure>, detail::type_list_of_structure_file_input_formats valid_formats_ = type_list<format_vienna>>
seqan3::structure_file_input< traits_type_, selected_field_ids_, valid_formats_ >::structure_file_input ( std::filesystem::path  filename,
selected_field_ids const &  fields_tag = selected_field_ids{} 

Construct from filename.

[in]filenamePath to the file you wish to open.
[in]fields_tagA seqan3::fields tag. [optional]
seqan3::file_open_errorif the file could not be opened, e.g. non-existent, non-readable, unknown format.

In addition to the file name, you may specify a custom seqan3::fields type which may be easier than defining all the template parameters.


This constructor transparently applies a decompression stream on top of the file stream in case the file is detected as being compressed. See the section on compression and decompression for more information.

◆ structure_file_input() [2/2]

template<structure_file_input_traits traits_type_ = structure_file_input_default_traits_rna, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::structure>, detail::type_list_of_structure_file_input_formats valid_formats_ = type_list<format_vienna>>
template<input_stream stream_t, structure_file_input_format file_format>
requires std::same_as<typename std::remove_reference_t<stream_t>::char_type, char>
seqan3::structure_file_input< traits_type_, selected_field_ids_, valid_formats_ >::structure_file_input ( stream_t &  stream,
file_format const &  format_tag,
selected_field_ids const &  fields_tag = selected_field_ids{} 

Construct from an existing stream and with specified format.

Template Parameters
file_formatThe format of the file in the stream, must satisfy seqan3::structure_file_input_format.
[in]streamThe stream to operate on; must be derived of std::basic_istream.
[in]format_tagThe file format tag.
[in]fields_tagA seqan3::fields tag. [optional]


This constructor transparently applies a decompression stream on top of the stream in case the file is detected as being compressed. See the section on compression and decompression for more information.

Member Function Documentation

◆ begin()

template<structure_file_input_traits traits_type_ = structure_file_input_default_traits_rna, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::structure>, detail::type_list_of_structure_file_input_formats valid_formats_ = type_list<format_vienna>>
iterator seqan3::structure_file_input< traits_type_, selected_field_ids_, valid_formats_ >::begin ( )

Returns an iterator to current position in the file.

An iterator pointing to the current position in the file.

Equals end() if the file is at end.




Throws seqan3::format_error if the first record could not be read into the buffer.

◆ end()

template<structure_file_input_traits traits_type_ = structure_file_input_default_traits_rna, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::structure>, detail::type_list_of_structure_file_input_formats valid_formats_ = type_list<format_vienna>>
sentinel seqan3::structure_file_input< traits_type_, selected_field_ids_, valid_formats_ >::end ( )

Returns a sentinel for comparison with iterator.

Iterator to the first element.

This element acts as a placeholder; attempting to dereference it results in undefined behaviour.




No-throw guarantee.

◆ front()

template<structure_file_input_traits traits_type_ = structure_file_input_default_traits_rna, detail::fields_specialisation selected_field_ids_ = fields<field::seq, field::id, field::structure>, detail::type_list_of_structure_file_input_formats valid_formats_ = type_list<format_vienna>>
reference seqan3::structure_file_input< traits_type_, selected_field_ids_, valid_formats_ >::front ( )

Return the record we are currently at in the file.

A reference to the currently buffered record.

This function returns a reference to the currently buffered record, it is identical to dereferencing begin(), but begin also always points to the current record on single pass input ranges:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <sstream>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
..(((((..(((...)))..)))))... (-3.71))";
int main()
auto it = std::ranges::begin(fin);
// the following are equivalent:
auto & rec0 = *it;
auto & rec1 = fin.front();
std::cout << std::boolalpha << ( == << '\n'; // true
// both become invalid after incrementing "it"!
T begin(T... args)
T boolalpha(T... args)

It most situations using the iterator interface or a range-based for-loop are preferable to using front(), because you can only move to the next record via the iterator.

In any case, don't forget the reference! If you want to save the data from the record elsewhere, use move:

// SPDX-FileCopyrightText: 2006-2024 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2024 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <sstream>
#include <utility>
auto input = R"(> S.cerevisiae_tRNA-PHE M10740/1-73
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))). (-17.50)
> example
..(((((..(((...)))..)))))... (-3.71))";
int main()
auto rec0 = std::move(fin.front());




No-throw guarantee.

The documentation for this class was generated from the following file:
Hide me