SeqAn3 3.4.3-rc.1
The Modern C++ library for sequence analysis.
Loading...
Searching...
No Matches
seqan3::sequence_file_input_default_traits_dna Struct Reference

The default traits for seqan3::sequence_file_input. More...

#include <seqan3/io/sequence_file/input.hpp>

+ Inheritance diagram for seqan3::sequence_file_input_default_traits_dna:

Public Types

Member types

Definitions to satisfy seqan3::sequence_file_input_traits.

using sequence_alphabet = dna5
 The sequence alphabet is seqan3::dna5.
 
using sequence_legal_alphabet = dna15
 The legal sequence alphabet for parsing is seqan3::dna15.
 
template<typename _sequence_alphabet >
using sequence_container = std::vector< _sequence_alphabet >
 The type of a DNA sequence is std::vector.
 
using id_alphabet = char
 The alphabet for an identifier string is char.
 
template<typename _id_alphabet >
using id_container = std::basic_string< _id_alphabet >
 The string type for an identifier is std::basic_string.
 
using quality_alphabet = phred42
 The alphabet for a quality annotation is seqan3::phred42.
 
template<typename _quality_alphabet >
using quality_container = std::vector< _quality_alphabet >
 The string type for a quality annotation is std::vector.
 

Additional Inherited Members

Detailed Description

The default traits for seqan3::sequence_file_input.

If you wish to change a single or a few types from the default, just inherit from this class and "overwrite" the respective type definitions.

This example will make the file read into a smaller alphabet and a compressed container:

// SPDX-FileCopyrightText: 2006-2026 Knut Reinert & Freie Universität Berlin
// SPDX-FileCopyrightText: 2016-2026 Knut Reinert & MPI für molekulare Genetik
// SPDX-License-Identifier: CC0-1.0
#include <sstream>
auto input = R"(>TEST1
ACGT
>Test2
AGGCTGA
>Test3
GGAGTATAATATATATATATATAT)";
{
using sequence_alphabet = seqan3::dna4; // instead of dna5
template <typename alph>
using sequence_container = seqan3::bitpacked_sequence<alph>; // must be defined as a template!
};
int main()
{
}
Provides seqan3::bitpacked_sequence.
A "pretty printer" for most SeqAn data structures and related types.
Definition debug_stream_type.hpp:79
The four letter DNA alphabet of A,C,G,T.
Definition dna4.hpp:50
The five letter DNA alphabet of A,C,G,T and the unknown character N.
Definition dna5.hpp:48
The FASTA format.
Definition format_fasta.hpp:77
Provides seqan3::dna4, container aliases and string literals.
Provides seqan3::sequence_file_input and corresponding traits classes.
The default traits for seqan3::sequence_file_input.
Definition sequence_file/input.hpp:130
Remarks
For a complete overview, take a look at Sequence File

The documentation for this struct was generated from the following file:
Hide me